Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 53
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0458 | 25188392 | 2014 | Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium | STM-binding aptamer | ATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT | 58 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Develop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM. | Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h. | N/A | LPS-Aptamer Plate Binding Assay | 19.59 ± 0.35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated | N/A | MMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed. | N/A | N/A | N/A |
| ABdb_0460 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 4F | ATACGGGAGCCAACACCATAATATGCCGTAAGGAGAGGCCTGTTGGGAGCGCCGTAGAGCAGGTGTGACGGAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0644 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCCTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | Display a sensitive detection of 200 nM alpha toxin. | 12 | Surface Plasmon Resonance (SPR) | 93.7 ± 7.0 nM | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) or 5'-FAM Labeled | N/A | N/A | N/A | Average half-life of ssDNA MREs in serum is about one hour. | N/A |
| ABdb_0645 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.26 | TGTACCGTCTGAGCGATTCGTAC-CCTTGCCGATGCCTTTACGGTCTAGTTTGGATGT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0646 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.01 | TGTACCGTCTGAGCGATTCGTAC-TCGGGCGATGATACTTAGCACGGTCTAGGTCAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0647 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.20 | TGTACCGTCTGAGCGATTCGTAC-TAGCGGCAGAGTAGCACTCTATAGGTCGATGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0648 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.02 | TGTACCGTCTGAGCGATTCGTAC-CGTGTCCTATTTTCTTCTCTGTTAACTCTCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 79 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0649 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCTTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0650 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.39 | TGTACCGTCTGAGCGATTCGTAC-TTTGATCTCGTGTGTCTAGTTGCGGCGGATTGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0651 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.10 | TGTACCGTCTGAGCGATTCGTAC-GGTCAACCTCACCGACTGCCGACCGTTTAATTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0652 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.43 | TGTACCGTCTGAGCGATTCGTAC-CGTCATTGCCTCGTAGTATTCTTATAGTCGGTAG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0653 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.44 | TGTACCGTCTGAGCGATTCGTAC-TCCCGAAAGCGCGTCAGCCTGGGAGGTTATGCGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0656 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.33 | TGTACCGTCTGAGCGATTCGTAC-CATAGGGTGCTTTTCAAGGCCACACGTTAGTGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | 100 nM or 6.6 μg/mL of Exotoxin A in human serum was detected. | 14 | Surface Plasmon Resonance (SPR) | 4.2 and 4.5 μM | Diagnostic | Decoy-SELEX | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0702 | 25467500 | 2015 | Pathogen detection in complex samples by quartz crystal microbalance sensor coupled to aptamer functionalized core-shell type magnetic separation | Aptamer | CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-based QCM biosensor for the determination of Salmonella in food samples. | Showed specific detection of Salmonella cells at 100 CFU/mL from a milk sample and a linear response range from 100 to 4 × 10(4) CFU/mL cells. | N/A | Quartz Crystal Microbalance (QCM) | 3259 CFU mL−1 | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0704 | https://doi.org/10.1039/C4AY02880E | 2015 | Rapid and sensitive detection of Salmonella typhimurium using aptamer-conjugated carbon dots as fluorescence probe | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a fluorescence probe based on amino-modified aptamer conjugated to carboxyl-modified carbon dots (CDs) for detection of Salmonella typhimurium. | Limit of Detection (LOD): 50 cfu mL⁻¹ and linear range of 10(3)-10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0746 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B5 | CAGTCCAGGACAGATTCGCGAG-CCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | LOD was 7.9 × 10(3) CFU/mL and a linear range from 7.9 × 10(2) to 7.9 × 10(6) CFU/mL of S. typhimurium with less than 1 h. | 10 | Quartz Crystal Microbalance (QCM) | 58.5 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0747 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A24 | CAGTCCAGGACAGATTCGCGAG-GCACAATCCACCTCTCACCGCACGCCACGCACTGCCTCTGTCCCG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 19.63 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0748 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B30 | AATCGCTGAATGAAATCCACGTG-GGAAGTGTGTGGGTGACCAGAGGTGTGGTGATGGGATTGTCGTA-CCTCGCGAATCTGTCCTGGACTG | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 51.02 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0749 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B31 | CAGTCCAGGACAGATTCGCGAG-CCGCACCGCCCTATCCTCGTGTCCCTGCCCAACAGCGCCGCCCGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0750 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A37 | CAGTCCAGGACAGATTCGCGAG-GTGGGGCGGGAAAGTGTGTGTAGGTGGTGGCGTTGTCACGGCGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0751 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B16 | CAGTCCAGGACAGATTCGCGAG-GGGCTGTGTGAGAAGTGGGTGTGGTGGTGGATATGCAACGTTGTA-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0752 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B21 | CAGTCCAGGACAGATTCGCGAG-GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0818 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 28 cfu/mL (S. typhimurium). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0977 | 28624620 | 2017 | AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensors | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a ECL aptasensor based on amine-functionalized E. coli aptamer and luminol/AgBr/3DNGH for the detection of E. coli. | Linear response range from 0.5 to 500 cfu/mL and Limit of Detection (LOD) of 0.17 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | No obvious change was observed for the response of a BSA/aptamer/GA/CHIT/luminol/AgBr/3DNGH/GCE when stored at 4°C for 12 d, indicating an acceptable stability of the aptasensor. | N/A | N/A | N/A |
| ABdb_1080 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTCCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-functionalized QD and UCNP nanoprobes conjugated with partially complementary DNA-modified magnetic beads for separation of different bacteria. | The limit of detection was 15 cfu/mL for S. aureus with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1081 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 28 cfu/mL for L. monocytogenes with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1082 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 25 cfu/mL for P. aeruginosa with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1083 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 12 cfu/mL for S. typhimurium with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1180 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | Sa1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1181 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | E1 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1190 | 29078201 | 2018 | Gold atomic cluster mediated electrochemical aptasensor for the detection of lipopolysaccharide | LPS aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptamer immobilized gold atomic cluster mediated, ultrasensitive electrochemical biosensor (Apt/AuAC/Au) for LPS detection. | Achieved a detection of LPS down to 7.94 × 10–21 M level with a wide dynamic range from 0.01 attomolar to 1 pM. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | The Apt/AuAC/Au electrode offers excellent stability when stored at 4°C for 1 week, with 95.54% of the signal retained. | N/A | N/A | N/A |
| ABdb_1257 | 31307721 | 2019 | Dual-recognition surface-enhanced Raman scattering(SERS)biosensor for pathogenic bacteria detection by using vancomycin-SERS tags and aptamer-Fe3O4@Au | S. aureus-aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a dual-recognition SERS biosensor using Vancomycin-Au@MBA and aptamer-Fe3O4@Au for the detection of pathogenic bacteria. | A detection limit of 3 cells/mL with a wide dynamic linear range from 10 to 10(7) cells/mL can be achieved within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1324 | 31732807 | 2019 | A glassy carbon electrode modified with reduced graphene oxide and gold nanoparticles for electrochemical aptasensing of lipopolysaccharides from Escherichia coli bacteria | LPS Aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 | Lipopolysaccharide (LPS) | An electrochemical aptasensor immobilized on a GCE modified with reduced graphene oxide and gold nanoparticles (RGO/AuNPs) was developed for the voltammetric determination of LPS from E. coli 055:B5. | Limit of Detection (LOD) of 1 fg/mL (using Mg/CQD media) or 30 fg/mL (using hexacyanoferrate). | N/A | N/A | 12 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1414 | https://doi.org/10.1016/j.foodcont.2020.107808 | 2020 | Development of a fluorescence aptasensor for rapid and sensitive detection of Listeria monocytogenes in food | L. monocytogenes Aptamer | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGGACAGCGCGGGAGGCACCGGGGATTCGACATGAGGCCCGGATC | 77 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | A fluorescence aptasensor based on aptamer-UCNP and aptamer-MNP complex was developed for the detection of L. monocytogenes. | A low limit of detection of 8 cfu/mL was estimated from the range of 68 to 68 × 10(6) cfu/mL. | N/A | N/A | 48.74 ± 3.11 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1547 | 34107210 | 2021 | A Low-Field Magnetic Resonance Imaging Aptasensor for the Rapid and Visual Sensing of Pseudomonas aeruginosa in Food, Juice, and Water | Anti-P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a low-field magnetic resonance imaging (LF-MRI) aptasensor based on the difference in magnetic behaviour of two magnetic nanoparticles with diameters of 10 (MN10) and 400 nm (MN400) for the rapid detection of P. aeruginosa. | Show a detection limit of 100 cfu/mL with a wide linear range from 3.1 × 10(2) to 3.1 × 10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1583 | 34945447 | 2021 | A Novel Photoelectrochemical Aptamer Sensor Based on CdTe Quantum Dots Enhancement and Exonuclease I-Assisted Signal Amplification for Listeria monocytogenes Detection | Aptamer | ATACCAGCTTATTCAATTCCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCGAGATTGCACTTACTATCT | 76 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed a photoelectrochemical aptasensor based on WO3, CdTe QDs, and Exo I auxiliary signal amplification for the detection of L. monocytogenes. | Showed a detection limit of 45 CFU/mL over the concentration range of 1.3 × 10(1) - 1.3 × 10 (7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1590 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | E. coli-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 35150) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1591 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | L. mono-aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Listeria Monocytogenes | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for L. mono. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1592 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | S. typhi-aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) for S. typhi was 25 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1595 | 34869216 | 2021 | Electrochemical Biosensing Interface Based on Carbon Dots-Fe3O4 Nanomaterial for the Determination of Escherichia coli O157:H7 | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A carbon dots-Fe3O4 nanomaterial (CDs-Fe3O4)-based electrochemical aptasensor for E. coli O157:H7 detection was developed. | Exhibited the detection range of 10–10(8) CFU/ml, and the detection limit of 6.88 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1747 | 37512948 | 2023 | Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo | αSA31 | ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 49 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591) | Whole cell | αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis. | 3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo. | N/A | N/A | N/A | Therapeutics | N/A | 5'-α-gal and 5'-Amidation (NH₂-(CH2)6) | No toxicity was observed, even at 10,000 µg/kg/day. | αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C. | N/A | 5.222 h in Human serum. | N/A |
| ABdb_1787 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | K2 | AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG | 45 | N/A | ssDNA | Klebsiella Pneumoniae (KP) | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 5.377 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1788 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | AB | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 6.8 nM | Biosensor | N/A | 5'-Cyanine5 (Cy5) Labeled and 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1843 | 39212695 | 2024 | Visual fluorescence detection of Listeria monocytogenes with CRISPR-Cas12a aptasensor | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptasensor utilizing carboxylated magnetic beads and Cas12a to detect L. monocytogenes. | Demonstrates excellent sensitivity towards L. monocytogenes, with a lowest detection limit (LOD) of 57.15 CFU/mL and a linear range of 4×10(2) to 4×10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1846 | 38169279 | 2024 | "Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal application | Anti-S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 65389) | Whole cell | A fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs). | The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1851 | 38180496 | 2024 | Development of an electrochemical sensitive aptasensor based on a zeolite imidazolate framework-8 and gold nanoparticles for the determination of Staphylococcus aureus bacteria | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on a glassy carbon electrode (GCE) modified with zeolite imidazolate framework-8 (ZIF 8) and gold nanoparticles (AuNPs) for the detection of S. aureus. | Showed a linear response in the concentration range of 1.5 × 10(1) to 1.5 × 10(7) CFU mL−1 and a detection limit of 3.4 CFU/mL. | N/A | N/A | (9.04 ± 1.27) × 10(−1) nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | Response of the proposed aptasensor reached 98.9%, 94.3%, and 92.8% of the initial response on the first, second, and third days, respectively, when kept at 4°C. | N/A | N/A | N/A |
| ABdb_1903 | 41339596 | 2025 | Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen | Apt | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum. | The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value. | N/A | N/A | N/A |
| ABdb_1952 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-cholera whole toxin aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Vibrio Cholerae | Cholera toxin | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 40 ng in the cholera electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |