Modification : 5'-Amidation (NH₂) or 5'-Thiolated

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1782	36549213	2023	Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags	Apt1	GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Escherichia Coli (E. Coli) (ATCC 25922)	Whole cell	A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus.	The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂) or 5'-Thiolated	N/A	N/A	N/A	N/A	N/A
ABdb_1783	36549213	2023	Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags	Apt2	GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Staphylococcus aureus (S. aureus) (CMCC 26003)	Whole cell	A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus.	The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂) or 5'-Thiolated	N/A	N/A	N/A	N/A	N/A