AptBacterialDB

Modification : 5'-Amidation (NH₂) and FITC Labeled

Total records found: 4

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0143 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E17F-72ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.N/AN/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0144 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E17F-37ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT37N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0145 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E18R-72ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGGAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.N/AN/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0146 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E18R-42CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/ABest CandidateN/AN/A