AptBacterialDB

Modification : 5'-Amidation (NH₂) and 5'-Biotinylated

Total records found: 12

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0054 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2FCATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0055 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5RGATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0056 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2RGATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_0057 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5FCATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC615'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_0898 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-4ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT775'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei.8Surface Plasmon Resonance (SPR)15.89 ± 1.77 nMBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1136 301659342018Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. TyphimuriumS11GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT1005'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNASalmonella Typhimurium (S. Typhimurium) ( ATCC 19585)Whole cellIdentify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium.N/A10Surface Plasmon Resonance (SPR)4.41 × 10(-12) MDetectionWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1188 288878142018Construction and application of an electrochemical biosensor based on an endotoxin aptamerEAQ2ATGAGAGCGTCGGTGTGGTATGCTCACCCCCTGCGGCGCCGTTACGCGGTCCTTGTGTAGGAGGGTGCGGAAGTA75N/AssDNAEscherichia Coli (E. Coli) 055:B5 (L2880)Lipopolysaccharide (LPS)An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin.N/AN/ABio-Layer Interferometry (BLI)32.5 nMBiosensorN/A5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1189 288878142018Construction and application of an electrochemical biosensor based on an endotoxin aptamerEAQ3ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTCTGTAGGAGGGTGCGGAAGTA75N/AssDNAEscherichia Coli (E. Coli) 055:B5 (L2880)Lipopolysaccharide (LPS)An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin.Showed a low detection limit of 0.001 EU/mL and a linear range of 0.001–1 EU/mL.N/ABio-Layer Interferometry (BLI)22.9 nMBiosensorN/A5'-Amidation (NH₂) and 5'-BiotinylatedN/AThe biosensor maintained a steady EIS response value after 1 week of storage in the PBS (10 mM, pH 7.4) at 4°C, and the response value still occupied 90%.Best CandidateN/AN/A
ABdb_1720 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB46GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.LOD value as low as 27 ± 11 cells.15Fluorescence Binding Assay616 ± 13 cells/mlBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1721 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB48GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1722 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB70GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells.15Fluorescence Binding Assay632 ± 132 cells/mlBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1723 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB72GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A