Modification : 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1345	30797466	2019	Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteria	E. coli O157:H7 aptamer	CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	42	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	A microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7.	The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1493	32800140	2020	Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detections	Aptamer	ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT	72	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Lipopolysaccharide (LPS)	Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells.	Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A