Modification : 5'-α-gal and 5'-Amidation (NH₂-(CH2)6)

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1747	37512948	2023	Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo	αSA31	ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA	49	N/A	ssDNA	Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591)	Whole cell	αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis.	3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo.	N/A	N/A	N/A	Therapeutics	N/A	5'-α-gal and 5'-Amidation (NH₂-(CH2)6)	No toxicity was observed, even at 10,000 µg/kg/day.	αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C.	N/A	5.222 h in Human serum.	N/A