Modification : 5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0676	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P (Parental)	AGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	5′-α-Gal, 3′-FAM α20A24P significantly increased phagocytosis in the presence of either transgenic mouse IgG or hIVIG.	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified	N/A	N/A	N/A	N/A	N/A