Modification : 5' or 3'-FAM Labeled

Total records found: 16

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0676	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P (Parental)	AGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	5′-α-Gal, 3′-FAM α20A24P significantly increased phagocytosis in the presence of either transgenic mouse IgG or hIVIG.	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified	N/A	N/A	N/A	N/A	N/A
ABdb_0677	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A2	AGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCT	69	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0678	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A3	AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCC	52	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	5′-α-Gal α20A24P.A3 significantly increased phagocytosis in the presence of either transgenic mouse IgG or human IVIG.	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled and 5′-α-Gal	N/A	N/A	N/A	N/A	N/A
ABdb_0679	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A4	AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCA	53	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0680	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A5	AGGTCAGATGGGGGGAAGACAC	22	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0681	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A6	AAGGCCGGGGTGAAGTGTAGAGGCCTA	27	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0682	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A8	TGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGC	43	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0683	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A9	AGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTAT	57	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0684	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	15A3P	TTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGGCATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0685	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A1P	TTCACGGTAGCACGCATAGGCAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCCCATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0686	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A8P	AGCAGCACAGAGGTCAGATGCCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCCCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0687	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A8	CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC	40	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0688	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A9P	AGCAGCACAGAGGTCAGATGCACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGGCCTATGCGTGCTACCGTGAA	79	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0689	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A9	CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG	39	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0690	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A12P	TTCACGGTAGCACGCATAGGGCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCCCATCTGACCTCTGTGCTGCT	78	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0691	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A14P	AGCAGCACAGAGGTCAGATGGGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGCCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A