Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1845 | 38006817 | 2024 | Electrocatalytic aptasensor for bacterial detection exploiting ferricyanide reduction by methylene blue on mixed PEG/aptamer monolayers | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Developed a disposable electrocatalytic “off–on” sensor for E. coli on Au SPE. | Exhibited a linear range of 10 to 1000 CFU/mL and LOD of 10 CFU/mL E. coli in 30 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (thiol-C6) | N/A | N/A | N/A | N/A | N/A |