Modification : 3'-Thiolated (SH-(CH2)3)

Total records found: 6

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0672	25476286	2015	Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species	Lac-apt	AGCAGCACAGAGGTCAGATGTAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTGCCTATGCGTGCTACCGTGAA	78	N/A	ssDNA	Lactobacillus Acidophilus (KCTC 3164)	Whole cell	The aptamer-immobilized LSPR sensor was developed for bacteria detection.	Showed a detection limit of 30 cfu per assay.	N/A	N/A	13 ± 3 nM	Biosensor	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A
ABdb_0673	25476286	2015	Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species	Sty-apt	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (KCTC 2421)	Whole cell	The aptamer-immobilized LSPR sensor was developed for bacteria detection.	Showed a detection limit of 30 cfu per assay.	N/A	N/A	N/A	Biosensor	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A
ABdb_0674	25476286	2015	Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species	Pae-apt	CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG	60	N/A	ssDNA	Pseudomonas Aeruginosa (ATCC 15692)	Whole cell	The aptamer-immobilized LSPR sensor was developed for bacteria detection.	Showed a detection limit of 30 cfu per assay.	N/A	N/A	17.27 ± 5 nM	Biosensor	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A
ABdb_0976	28860462	2017	Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat	Aptamer	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (KCTC 2421)	Whole cell	Develop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples.	Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes.	N/A	N/A	N/A	Biosensor	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A
ABdb_1230	31472413	2019	Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood	P. aeruginosa aptamer	CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG	60	N/A	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time.	Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for S. aureus was approximately 1 and 0.1 μg/mL for gentamicin and amikacin, respectively,	N/A	N/A	N/A	Biosensor	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A
ABdb_1372	32792573	2020	Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates	Aptamer 4	CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG	60	N/A	ssDNA	Pseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL)	Whole cell	Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations.	The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%).	N/A	N/A	N/A	Diagnostic	N/A	3'-Thiolated (SH-(CH2)3)	N/A	N/A	N/A	N/A	N/A