AptBacterialDB

Modification : 3'-Thiolated (HS-(CH2)6)

Total records found: 6

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1549 330760892021Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimuriumAptamer1AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium.Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1550 330760892021Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimuriumAptamer2TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium.Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1648 359343732022A surface-enhanced Raman scattering aptasensor for Escherichia coli detection based on high-performance 3D substrate and hot spot effectE. coli AptCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG45N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped SERS aptasensor composed of Apt-AgNPs-CS gel and GNS@4-MBA-Apt NPs for detection of E. coli in food.Display a detection limit of 3.46 CFU/mL with a wide dynamic linear range from 3.2 × 10(1) to 3.2 × 10(7) CFU/mL and a good recovery rate (>90%).N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1657 358842432022Label-Free Electrochemical Aptasensor for the Detection of the 3-O-C12-HSL Quorum-Sensing Molecule in Pseudomonas aeruginosaAPTGCAATGGTACGGTACTTCCCGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCGCAAAAGTGCACGCTACTTTGCTAA78N/AssDNAPseudomonas Aeruginosa (ATCC 27853)N-3-oxo-dodecanoyl L-homoserine lactone (3-O-C12-HSL)An electrochemical aptasensor using a carbon-based SPE modified with AuNPs was developed for the detection of 3-O-C12-HSL.Exhibited a logarithmic range from 0.5 to 30 µM, with a limit of detection of 145 ng mL−1 (0.5 µM).N/ASurface Plasmon Resonance (SPR)106.7 ± 9.3 nMBiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1799 369619212023Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell LevelS. aureus aptamerTCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC62N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)Whole cellAn electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt).The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AAfter storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal.N/AN/AN/A
ABdb_1841 397279012024Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A DetectionAPTATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)Staphylococcus aureus Protein A (SpA)Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus.Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A