Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |