Modification : 3'-Thiolated (A10-Thiol)

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0730	27424215	2016	Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium	AptHis (6H7)	GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC	40	N/A	ssDNA	Salmonella typhimurium infected HeLa cells	S. typhimurium Whole cell	His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells.	80% viability increase of infected HeLa cells and 100% survival rate of infected mice.	N/A	N/A	N/A	Targeted Delivery/Therapeutics	N/A	3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled	AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells.	∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His).	N/A	N/A	N/A
ABdb_0954	29051620	2017	Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus	Apt(His)	GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC	40	N/A	ssDNA	Vibrio Vulnificus (MO6-24/O)	V. vulnificus-infected HeLa cells	The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity.	Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h.	N/A	N/A	N/A	Targeted Delivery/Therapeutics	N/A	3'-Thiolated (A10-Thiol)	HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM.	N/A	N/A	N/A	N/A