Modification : 3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂)

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1000	https://doi.org/10.1016/j.jelechem.2017.10.054	2017	Development of an aptasensor using reduced graphene oxide chitosan complex to detect Salmonella	Aptamer	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium)	Whole cell	Developed a rGO-CHI electrochemical aptasensor to detect Salmonella.	Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL.	N/A	N/A	N/A	Biosensor	N/A	3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂)	N/A	N/A	N/A	N/A	N/A