AptBacterialDB

Modification : 3'-Thiolated

Total records found: 26

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0463 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSe1CACACCGGAAGGGATGCCACCTAAACCCC295'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAP of Se1 was approximately 100-fold higher than that of the single aptamer.10Fluorescence Spectroscopy4.66 ± 0.35 μM (of single aptamer) and 57.86 ± 14.5 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A
ABdb_0464 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSe2CACAGATGACGTCTGGCACATAATTAACAC305'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAP for Se2 was approximately 80-fold higher than that of the single aptamer.10Fluorescence Spectroscopy3.83 ± 0.10 μM (of single aptamer) and 55.84 ± 24.7 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A
ABdb_0465 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSt1CCGATGTCCGTTAGGGCTCCTCCATAGAT295'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Typhimurium (S. Typhimurium)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAPs of St1 was approximately 20-fold higher than that of the single aptamer.10Fluorescence Spectroscopy0.530 ± 0.01 μM (of single aptamer) and 25 ± 5.6 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A
ABdb_0672 254762862015Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial speciesLac-aptAGCAGCACAGAGGTCAGATGTAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTGCCTATGCGTGCTACCGTGAA78N/AssDNALactobacillus Acidophilus (KCTC 3164)Whole cellThe aptamer-immobilized LSPR sensor was developed for bacteria detection.Showed a detection limit of 30 cfu per assay.N/AN/A13 ± 3 nMBiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_0673 254762862015Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial speciesSty-aptTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (KCTC 2421)Whole cellThe aptamer-immobilized LSPR sensor was developed for bacteria detection.Showed a detection limit of 30 cfu per assay.N/AN/AN/ABiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_0674 254762862015Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial speciesPae-aptCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 15692)Whole cellThe aptamer-immobilized LSPR sensor was developed for bacteria detection.Showed a detection limit of 30 cfu per assay.N/AN/A17.27 ± 5 nMBiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_0730 274242152016Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar TyphimuriumAptHis (6H7)GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC40N/AssDNASalmonella typhimurium infected HeLa cellsS. typhimurium Whole cellHis-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells.80% viability increase of infected HeLa cells and 100% survival rate of infected mice.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) LabeledAuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells.∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His).N/AN/AN/A
ABdb_0819 272095742016A paper based graphene-nanocauliflower hybrid composite for point of care biosensingRNA AptamerGGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA64N/AssRNAEscherichia Coli (E. Coli) O157:H7(ATCC 43895)O-antigenDevelop electrochemical biosensing platform using graphene paper functionalized with fractal platinum nanocauliflower for detection of E. coli O157:H7.Detection limit (LOD) of ~4 CFU/mL with linear range of 4 to 10(5) CFU/mL and a response time of 12 min.N/AN/A110 nMBiosensorN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0833 287780622017DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureusAptamerATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA755'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA) standard strain 43300Whole cellAptamer-functionalized gold nanorods (Apt@Au NRs) for inactivation of MRSA with targeted photothermal therapy (PTT).Over 95% inactivation of MRSA cells within 2 min.N/AN/AN/ATherapeuticsN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0953 291608512017Development of An Impedimetric Aptasensor for the Detection of Staphylococcus aureusPA#2/8[S1-58]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) (DSM 20231)Staphylococcus aureus Protein A (SpA)Developed an impedimetric aptasensor for the detection of S. aureus.Showed a limit of detection of 10 CFU/mL within 10 minutes.N/AElectrochemical impedance spectroscopy (EIS)18.5 ± 1.8BiosensorN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_0954 290516202017Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificusApt(His)GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC40N/AssDNAVibrio Vulnificus (MO6-24/O)V. vulnificus-infected HeLa cellsThe AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity.Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Thiolated (A10-Thiol)HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM.N/AN/AN/AN/A
ABdb_0976 288604622017Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meatAptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (KCTC 2421)Whole cellDevelop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples.Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes.N/AN/AN/ABiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_1000 https://doi.org/10.1016/j.jelechem.2017.10.0542017Development of an aptasensor using reduced graphene oxide chitosan complex to detect SalmonellaAptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellDeveloped a rGO-CHI electrochemical aptasensor to detect Salmonella.Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL.N/AN/AN/ABiosensorN/A3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂)N/AN/AN/AN/AN/A
ABdb_1093 303505642018Aptamer-Based TB Antigen Tests for the Rapid Diagnosis of Pulmonary Tuberculosis: Potential Utility in Screening for TuberculosisH63 SL-2-M6AGGGCTTTTTTTTTTTTTAGTTCGTTTG28N/AssDNAMycobacterium Tuberculosis (M.Tb.)HspX antigenDeveloped an Aptamer ALISA and an electrochemical sensor (ECS) for the direct detection of HspX in sputum.Aptamer ALISA demonstrated excellent sensitivity of 94.1% (95% CI, 86.8–98%) and specificity of 100% (95% CI, 98.4–100%). Aptamer-based ECS detected HspX at ∼13 pM.N/AN/AN/ABiosensorN/AALISA: 5′-Biotinylated and ECS: 5'-Methylene Blue (MB) and 3'-ThiolatedN/AN/AN/AN/AIndian Patent application no. 201611001550
ABdb_1230 314724132019Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in bloodP. aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellVertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time.Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for S. aureus was approximately 1 and 0.1 μg/mL for gentamicin and amikacin, respectively,N/AN/AN/ABiosensorN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_1372 327925732020Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolatesAptamer 4CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL)Whole cellElectrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations.The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%).N/AN/AN/ADiagnosticN/A3'-Thiolated (SH-(CH2)3)N/AN/AN/AN/AN/A
ABdb_1549 330760892021Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimuriumAptamer1AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium.Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1550 330760892021Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimuriumAptamer2TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium.Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1648 359343732022A surface-enhanced Raman scattering aptasensor for Escherichia coli detection based on high-performance 3D substrate and hot spot effectE. coli AptCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG45N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped SERS aptasensor composed of Apt-AgNPs-CS gel and GNS@4-MBA-Apt NPs for detection of E. coli in food.Display a detection limit of 3.46 CFU/mL with a wide dynamic linear range from 3.2 × 10(1) to 3.2 × 10(7) CFU/mL and a good recovery rate (>90%).N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1657 358842432022Label-Free Electrochemical Aptasensor for the Detection of the 3-O-C12-HSL Quorum-Sensing Molecule in Pseudomonas aeruginosaAPTGCAATGGTACGGTACTTCCCGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCGCAAAAGTGCACGCTACTTTGCTAA78N/AssDNAPseudomonas Aeruginosa (ATCC 27853)N-3-oxo-dodecanoyl L-homoserine lactone (3-O-C12-HSL)An electrochemical aptasensor using a carbon-based SPE modified with AuNPs was developed for the detection of 3-O-C12-HSL.Exhibited a logarithmic range from 0.5 to 30 µM, with a limit of detection of 145 ng mL−1 (0.5 µM).N/ASurface Plasmon Resonance (SPR)106.7 ± 9.3 nMBiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1784 https://doi.org/10.1016/j.snb.2023.1335542023A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRsAptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus.Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions.N/AN/AN/ABiosensorN/A3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_1799 369619212023Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell LevelS. aureus aptamerTCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC62N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)Whole cellAn electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt).The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AAfter storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal.N/AN/AN/A
ABdb_1815 https://doi.org/10.1016/j.cej.2023.1430992023Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteriaAptamer (AA)AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA118N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 6538)Whole cellDeveloped a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA.Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL.N/AN/AN/ABiosensorN/A5'-FAM Labeled and 3'-ThiolatedN/AN/AN/AN/AN/A
ABdb_1841 397279012024Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A DetectionAPTATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)Staphylococcus aureus Protein A (SpA)Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus.Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min.N/AN/AN/ABiosensorN/A3'-Thiolated (HS-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1845 380068172024Electrocatalytic aptasensor for bacterial detection exploiting ferricyanide reduction by methylene blue on mixed PEG/aptamer monolayersAptamerATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT73N/AssDNAEscherichia Coli (E. Coli) strain 8739 (Crooks strain)Outer membrane protein (OMP)Developed a disposable electrocatalytic “off–on” sensor for E. coli on Au SPE.Exhibited a linear range of 10 to 1000 CFU/mL and LOD of 10 CFU/mL E. coli in 30 min.N/AN/AN/ABiosensorN/A3'-Thiolated (thiol-C6)N/AN/AN/AN/AN/A
ABdb_1910 409313012025A novel fluorescent aptasensor using magnetic silica nanospheres and Ag@MOF nanocomposites for extraction and detection of Salmonella Typhimurium in eggsAptamerTATGGCGGCGTCACCCGACGGGGACTTGCATTATGACAG39N/AssDNASalmonella Typhimurium (S. Typhimurium) (PTCC 1709)Whole cellDeveloped a fluorescent platform based on an aptamer-Ag@MOF and Fe3O4@KCC‐1 probes for the detection of S. Typhimurium in eggs.Achieved a linear detection range of 7.5 to 7.5 × 10⁶ CFU/mL, a detection limit of 4.61 CFU/mL, and a total detection time of 90 min.N/AN/AN/ABiosensorN/A3'-ThiolatedN/AN/AN/AN/AN/A