Modification : 3'-FAM Labeled

Total records found: 51

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0676	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P (Parental)	AGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	5′-α-Gal, 3′-FAM α20A24P significantly increased phagocytosis in the presence of either transgenic mouse IgG or hIVIG.	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled, 5′-α-Gal or Biotin-TEG modified	N/A	N/A	N/A	N/A	N/A
ABdb_0677	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A2	AGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCT	69	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0678	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A3	AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCC	52	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	5′-α-Gal α20A24P.A3 significantly increased phagocytosis in the presence of either transgenic mouse IgG or human IVIG.	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled and 5′-α-Gal	N/A	N/A	N/A	N/A	N/A
ABdb_0679	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A4	AGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCA	53	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0680	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A5	AGGTCAGATGGGGGGAAGACAC	22	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0681	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A6	AAGGCCGGGGTGAAGTGTAGAGGCCTA	27	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0682	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A8	TGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGC	43	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0683	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A24P.A9	AGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTAT	57	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0684	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	15A3P	TTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGGCATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0685	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A1P	TTCACGGTAGCACGCATAGGCAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCCCATCTGACCTCTGTGCTGCT	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0686	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A8P	AGCAGCACAGAGGTCAGATGCCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCCCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0687	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A8	CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC	40	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0688	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A9P	AGCAGCACAGAGGTCAGATGCACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGGCCTATGCGTGCTACCGTGAA	79	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0689	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A9	CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG	39	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0690	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A12P	TTCACGGTAGCACGCATAGGGCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCCCATCTGACCTCTGTGCTGCT	78	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0691	25940316	2015	Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer	20A14P	AGCAGCACAGAGGTCAGATGGGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGCCCTATGCGTGCTACCGTGAA	80	N/A	ssDNA	Group A Streptococcus (GAS) M serotypes	M protein	Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro.	N/A	N/A	Flow Cytometry	N/A	Therapeutics	N/A	5' or 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0790	26592593	2016	Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7	EA2	CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	42	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7.	N/A	N/A	N/A	N/A	Biosensor	N/A	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0793	26592593	2016	Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7	EA5	CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	42	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7.	N/A	N/A	N/A	N/A	Biosensor	N/A	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0794	26592593	2016	Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7	EA6	GGGGGGTTTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	52	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7.	The limit of detection (LOD) was as low as 4.5×10(3) cfu/ml, with a linear range of 10(4)-10(7) cfu/ml.	N/A	N/A	N/A	Biosensor	N/A	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0809	27411775	2016	Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition	Apt-S. aureus	TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT	71	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria.	Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL).	N/A	N/A	N/A	Detection	N/A	3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM)	N/A	N/A	N/A	N/A	N/A
ABdb_0982	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-01	CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0983	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-02	CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0984	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-03	CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis.	18	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0985	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-04	ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC	39	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0986	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-05	CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC	38	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0987	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-06	GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0988	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-07	GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0989	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-08	GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0990	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-09	GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0991	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-10	AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0992	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-11	AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0993	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-12	GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	STC-12 showed better affinity to E. coli and S. epidermidis.	18	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0994	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-13	GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT	40	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0995	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-14	CGGGGTGGGACCAGTCTTGCGCGGGTGAC	29	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0996	28272554	2017	Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX	STC-15	GGACTGGAGTCTAGACCGGGTAGCTGTGGT	30	5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)	Whole cell	Identify aptamers with broad affinity for bacteria across different genera.	N/A	18	N/A	N/A	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1202	30001487	2018	Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens	S. typ aptamer	ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT	87	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 14028)	Whole cell	Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens.	The detection limits of 150 cfu/mL in milk, 120 cfu/mL in human serum, and 120 cfu/mL in human urine for S. typ.	N/A	N/A	N/A	Biosensor	N/A	5'-Biotinylated and 3'-FAM Labeled	Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h.	N/A	N/A	N/A	N/A
ABdb_1282	31511614	2019	Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers	GN6	ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT	76	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssDNA	Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens)	Whole cell	Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria.	Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively.	12	Fluorescence Binding Assay	29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	5'-Biotinylated and 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1283	31511614	2019	Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers	GN12	ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT	76	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssDNA	Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens)	Whole cell	Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria.	GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested.	12	Fluorescence Binding Assay	20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens)	Detection	Sequential Toggle Cell-SELEX (STC-SELEX)	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1349	31953175	2020	Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells	Apt17	TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA	86	5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3'	ssDNA	Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68	SipA protein	Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion.	70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively.	9	Fluorescence Spectroscopy	114.9 nM (at 27°C) and 63.4nM (at 37°C)	Therapeutics	Magnetic Bead (MB)-based SELEX	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1357	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20–5	GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	3.9 ± 0.6 nM	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1358	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20–7	GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	8 ± 0.9 nM	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1359	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20–10	GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	10.1 ± 1.7 nM	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1360	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-1	GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA	87	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1361	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-2	GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1362	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-3	GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA	85	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1363	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-4	GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1364	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-6	GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1365	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-8	GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1366	31837967	2020	Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method	20-9	GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA	88	5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3'	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Whole cell	Isolate aptamers against bacterial cells.	Aptamer selection was much faster compared to SELEX-based aptamer isolation.	20	Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)	N/A	Detection	Centrifugation-based Partitioning Method	3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1468	32095939	2020	A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag	Ab-Apt	TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT	43	N/A	ssDNA	Acinetobacter Baumannii	Whole cell	A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt).	The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Phosphate and 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1469	32095939	2020	A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag	LPS-Apt	CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT	86	N/A	ssDNA	Acinetobacter Baumannii	Lipopolysaccharide (LPS)	A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt).	The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Phosphate and 3'-FAM Labeled	N/A	N/A	N/A	N/A	N/A