AptBacterialDB

Modification : 3'-Cyanine3 (Cy3) Labeled

Total records found: 8

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0792 265925932016Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7EA4CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellDevelop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7.N/AN/AN/AN/ABiosensorN/A3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1022 295809442018Inhibition of anthrax lethal factor by ssDNA aptamersML12 (30mer)CGAGGGAGACGCGAACCTTCTCGCCTTGGG305'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNABacillus Anthracis (BA)Lethal factor (LF)Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity.Effective inhibitor of LF with an IC₅₀ of 15 ± 1.5 µM and ~85% cell viability.8Fluorescence Spectroscopy11.0 ± 2.7 nMTherapeuticsSELEX3'-Cyanine3 (Cy3) LabeledIn RAW 264.7 cells, the cell viability remained unchanged from 0.08 to 10 µM of ML12, indicating that it appears to be non-toxic.N/ABest CandidateN/AN/A
ABdb_1023 295809442018Inhibition of anthrax lethal factor by ssDNA aptamersML6GGACCAGCCGCCGCGCCTTGACCGGGGGTA305'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNABacillus Anthracis (BA)Lethal factor (LF)Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity.N/A8Fluorescence SpectroscopyN/ATherapeuticsSELEX3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1024 295809442018Inhibition of anthrax lethal factor by ssDNA aptamersML7GGAGAGAGGGAGACGCGCAACCTCGACCCGT315'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNABacillus Anthracis (BA)Lethal factor (LF)Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity.N/A8Fluorescence SpectroscopyN/ATherapeuticsSELEX3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1025 295809442018Inhibition of anthrax lethal factor by ssDNA aptamersML12 (60mer)GCGCGGATCCCGCGC-CGAGGGAGACGCGAACCTTCTCGCCTTGGG-CGCGCGAAGCTTGCG605'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNABacillus Anthracis (BA)Lethal factor (LF)Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity.N/A8Fluorescence Spectroscopy17.5 ± 4.8 nMTherapeuticsSELEX3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1201 300014872018Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple PathogensE. coli aptamerATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7 (CICC 21530)Whole cellAptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens.The detection limits were 100 cfu/mL in milk, 80 cfu/mL in human serum, and 80 cfu/mL in human urine for E. coli.N/AN/AN/ABiosensorN/A5'-Biotinylated and 3'-Cyanine3 (Cy3) LabeledBacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h.N/AN/AN/AN/A
ABdb_1345 307974662019Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteriaE. coli O157:H7 aptamerCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellA microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7.The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1493 328001402020Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detectionsAptamerATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells.Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A