AptBacterialDB

Modification : 3'-C3-Pyr

Total records found: 2

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0140 221541692012Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamersPyr-AptamerGCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellA single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time.With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL.N/AN/AN/ADetectionN/A3'-C3-PyrN/AN/AN/AN/AN/A
ABdb_0415 243259832014Graphene-based potentiometric biosensor for the immediate detection of living bacteriaSA31GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (CECT 4630)Whole cellDeveloped a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus.Able to detect 1 CFU/mL in a few minutes.N/AN/AN/ABiosensorN/A3'-C3-PyrN/AN/AN/AN/AN/A