Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1322 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-2 | GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 19.3 ± 3.7 nM | Detection | Whole Cell-SELEX | 3'-Biotinylated (biotin-AAAAAAAAAA) | N/A | N/A | N/A | N/A | N/A |