Modification : 3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled

Total records found: 1

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0024 171888712007In vitro selection of RNA aptamer against Escherichia coli release factor 1Class II-1GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC85N/AssRNAEscherichia Coli (E. Coli)Release factor 1 (RF-1)Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression.Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%).11Surface Plasmon Resonance (SPR)30 ± 6 nMTherapeuticsSELEX3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed LabeledN/AN/AN/AN/AN/A