Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0024 | 17188871 | 2007 | In vitro selection of RNA aptamer against Escherichia coli release factor 1 | Class II-1 | GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC | 85 | N/A | ssRNA | Escherichia Coli (E. Coli) | Release factor 1 (RF-1) | Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression. | Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%). | 11 | Surface Plasmon Resonance (SPR) | 30 ± 6 nM | Therapeutics | SELEX | 3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |