Modification : 3'-Biotinylated

Total records found: 31

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0024	17188871	2007	In vitro selection of RNA aptamer against Escherichia coli release factor 1	Class II-1	GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC	85	N/A	ssRNA	Escherichia Coli (E. Coli)	Release factor 1 (RF-1)	Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression.	Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%).	11	Surface Plasmon Resonance (SPR)	30 ± 6 nM	Therapeutics	SELEX	3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0048	18214875	2008	Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors	Aptamer	GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU	81	N/A	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli.	The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min.	N/A	N/A	N/A	Detection	SELEX	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0574	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#2/8	ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	PA#2/8 competes with IgG or IgG-Fc for binding to Protein A.	11	Bead-based Binding Assay	1.06 ±0.2 μM	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0575	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#4/22	ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0576	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#4/34	ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0577	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#2/11	ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0578	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#2/3	ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0579	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#2/6	ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0580	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#14/82	ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0581	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#6/52	ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0582	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#2/14	ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0583	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#4/31	ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0584	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#6/41	ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG	77	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0585	26221730	2015	In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A	PA#6/43	ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838)	Staphylococcus aureus Protein A (SpA)	Identify aptamers against Protein A.	N/A	11	Bead-based Binding Assay	N/A	Detection	FluMag-SELEX	5'-Fluorescein Labeled and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0695	25702275	2015	A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification	Capture-aptamer (c-aptamer)	TTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	45	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Outer membrane protein (OMP)	Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli.	Can detect as low as 10 CFU/mL.	N/A	N/A	N/A	Biosensor	N/A	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0776	27871171	2016	Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats	Ec3 (31) -Truncated	UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG	31	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.	Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells.	12	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	225 nM	Biosensor	Whole Cell-SELEX	2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0777	27871171	2016	Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats	Ec3	AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU	76	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.	N/A	12	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Biosensor	Whole Cell-SELEX	2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0778	27871171	2016	Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats	Ec2	AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU	74	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.	N/A	12	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Biosensor	Whole Cell-SELEX	2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0779	27871171	2016	Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats	Ec5	AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU	77	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.	N/A	12	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	N/A	Biosensor	Whole Cell-SELEX	2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0784	27650576	2016	G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA	PA#2/8	ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG	76	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838, P6031)	Staphylococcus aureus Protein A (SpA)	Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.	PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain.	N/A	Enzyme-Linked Oligonucleotide Assay (ELONA)	101.4 ± 5.9 nM (of 3′-biotinylated) and 189.9 ± 13.0 nM (of 5′-biotinylated)	Detection	N/A	5'-and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0785	27650576	2016	G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA	PA#2/8[S1-58]	ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT	58	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838, P6031)	Staphylococcus aureus Protein A (SpA)	Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.	PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain.	N/A	Enzyme-Linked Oligonucleotide Assay (ELONA)	11.3 ± 1.4 nM (of 3′-biotinylated) and 23.7 ± 2.0 nM (of 5′-biotinylated)	Detection	N/A	5'-and 3'-Biotinylated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0786	27650576	2016	G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA	PA#2/8[S1-50]	ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC	50	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838, P6031)	Staphylococcus aureus Protein A (SpA)	Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.	N/A	N/A	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	N/A	5'-and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0787	27650576	2016	G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA	PA#2/8[S1-43]	ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG	43	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838, P6031)	Staphylococcus aureus Protein A (SpA)	Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.	N/A	N/A	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	N/A	5'-and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0788	27650576	2016	G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA	PA#2/8[S28-50]	AGGGGGATAGAGGGGGTGGGTTC	23	5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'	ssDNA	Staphylococcus aureus (S. aureus) (P3838, P6031)	Staphylococcus aureus Protein A (SpA)	Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.	N/A	N/A	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	N/A	5'-and 3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_0959	28107930	2017	A chemiluminescent aptasensor based on rolling circle amplification and Co2+/N-(aminobutyl)-N-(ethylisoluminol) functional flowerlike gold nanoparticles for Salmonella typhimurium detection	S. typhimurium aptamer	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 14028)	Whole cell	Chemiluminescent aptasensor based on rolling circle amplification (RCA) using Co2+/ABEI-AuNFs-cDNA complex was developed for the detection of S. typhimurium.	The limit of detection (LOD) was 10 cfu/mL. The method exhibited excellent selectivity over non-target bacteria.	N/A	N/A	N/A	Biosensor	N/A	3'-Biotinylated (Biotin-TTTTTT)	N/A	N/A	N/A	N/A	N/A
ABdb_0966	https://doi.org/10.1016/j.snb.2017.07.074	2017	A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone	Direct Dot-Blot Aptamer	GGCGCCATAGCGACGGGGCCATTCCAAGAA	30	N/A	ssDNA	Mycobacterium Tuberculosis (H37Ra)	Mannose-capped lipoarabinomannan (ManLAM) epitope	Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection.	The direct dot-blot system provided a lower limit of quantitation of 10(4) CFU/mL and greater accuracy.	N/A	N/A	N/A	Detection	N/A	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1255	30608683	2019	Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification	A-Apt	TACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCAAAAAAAAAA	71	N/A	ssDNA	Vibrio Parahaemolyticus (ATCC 17802)	Whole cell	A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus.	Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples.	N/A	N/A	N/A	Biosensor	N/A	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1322	31563315	2019	Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol	Apt-2	GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT	60	5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3'	ssDNA	Lactobacillus Casei (ATCC 393)	Whole cell	An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products.	Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL.	8	Flow Cytometry	19.3 ± 3.7 nM	Detection	Whole Cell-SELEX	3'-Biotinylated (biotin-AAAAAAAAAA)	N/A	N/A	N/A	N/A	N/A
ABdb_1381	32289369	2020	Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification	Apt A	ATATACACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT	43	N/A	ssDNA	Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802)	Staphylococcus aureus Protein A (SpA)	Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA.	Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude.	N/A	N/A	N/A	Detection	N/A	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1382	32289369	2020	Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification	Apt B	CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT	38	N/A	ssDNA	Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802)	Penicillin binding protein 2a (PBP2a)	Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA.	Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude.	N/A	N/A	N/A	Detection	N/A	3'-Biotinylated	N/A	N/A	N/A	N/A	N/A
ABdb_1614	36276899	2022	Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate	AptBH	AAACCTGCTTATCTAAGGGGGGGAGGGGGGGTAGTGGGTGGGT	43	N/A	ssDNA	Streptococcus Mutans (PTCC 1683)	Fibronectin/fibrinogen-binding protein (FBP)	Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation.	AptBH-AgNPs at a concentration of 100 μg/mL after 48 h inhibited 43% of the biofilm formation and degraded 63% of the formed biofilm.	N/A	N/A	N/A	Therapeutics	N/A	3'-Biotinylated	AgNPs-AptBH is weakly toxic, with cell viability of 96% even at 100 μg/mL. At 75 and 100 μg/mL, these concentrations caused ∼approximately 9% and 11% hemolysis, respectively.	AgNPs-AptBH complex has not decomposed over time for 360 min in the cell culture medium.	Best Candidate	N/A	N/A