Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1911 | 40839054 | 2025 | SERS-based aptasensor for culture-free detection of Escherichia coli in urinary tract infection diagnosis | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Developed a SERS-based aptasensor for the detection of E. coli. | Demonstrated a detection limit of 5.9 × 10(3) CFU/mL, which is well below the UTI cutoff value. | N/A | N/A | N/A | Biosensor | N/A | 3'-BHQ2 | N/A | N/A | N/A | N/A | N/A |