Modification : 3'-Amidation (NH₂-(CH2)7)

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0809	27411775	2016	Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition	Apt-S. aureus	TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT	71	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria.	Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL).	N/A	N/A	N/A	Detection	N/A	3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM)	N/A	N/A	N/A	N/A	N/A
ABdb_0810	27411775	2016	Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition	Apt-E. coli	ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT	81	N/A	ssDNA	Escherichia Coli (E. Coli)	Whole cell	Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria.	Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL).	N/A	N/A	N/A	Detection	N/A	3'-Amidation (NH₂-(CH2)7)	N/A	N/A	N/A	N/A	N/A