AptBacterialDB

Modification : 3'-Amidation (NH₂-(CH2)6)

Total records found: 12

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0139 221541692012Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamersNH2-AptamerGCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellA single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time.With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL.N/AN/AN/ADetectionN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0333 238720602013Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteriaA1GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC71N/AssRNASalmonella Typhi (CECT 409)Type IVB Pili structural proteinsDevelop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria.Display linear range from 0.2 CFU/mL (1 CFU in 5 mL PBS) to 10(6) CFU/mL of ST and LOD of 0.2 CFU/mL.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0334 238720602013Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteriaA2GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU81N/AssRNAEscherichia Coli (E. Coli) (CECT 675)Type IVB Pili structural proteinsDevelop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria.Display linear range from 4 to 10(4) CFU/mL and LOD of 4 CFU/mL, and the signal was stable after 120 s.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0335 238720602013Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteriaA3GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (CECT 4630)Type IVB Pili structural proteinsDevelop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria.Display linear range from 8 × 10(2) CFU/mL–10(8) CFU/mL with LOD of 8 x10(2) CFU/mL and the signal was stable for at least one hour.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0414 243259832014Graphene-based potentiometric biosensor for the immediate detection of living bacteriaSA20GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (CECT 4630)Whole cellDeveloped a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus.Able to detect 1 CFU/mL in a few minutes.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_0975 287158742017Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamerAntibac1TCGCGCGAGTCGTCTGGGGACAGGGAGTGCGCTGCTCCCCCCGCACGTCCTCCC54N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 25923)PeptidoglycanRadiolabeled aptamers were evaluated for biodistribution studies and scintigraphic imaging in infection‐bearing mice.Achieved a high target-to-non-target (T/NT) ratio of 4.7 ± 0.9 at 1.5 h and 4.6 ± 0.1 at 3.0 h in bacterial-infected models.N/ABinding Assay0.170 ± 0.032 μMImagingN/A5'-Inverted Thymidine (5'-idT), 3'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (99mTc labeled)N/ARadiolabeling yields were superior to 90% and 99mTc‐Antibac1 was highly stable in the presence of saline, plasma, and cysteine up to 6 h.N/ADistribution half-life: 6.7 min and Elimination half-life: 41.3 min.N/A
ABdb_1072 300141632018Selective capture and sensitive fluorometric determination of Pseudomonas aeruginosa by using aptamer modified magnetic nanoparticlesP. aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellA fluorometric assay for the detection of the food pathogen P. aeruginosa based on hybridization of aptamer and FAM-cDNA (aptamer&FAM-cDNA@MNPs).Display a linear range between 10 and 10(8) cfu/mL, with a detection limit as low as 1 cfu/mL. The detection process can be finished within <1.5 h.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1123 294140892018A sensitive Potentiometric resolved ratiometric Photoelectrochemical aptasensor for Escherichia coli detection fabricated with non-metallic nanomaterialsE. coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Surface proteinDevelops a sensitive potentiometric resolved ratiometric photoelectrochemical aptasensor for the detection of E. coli.Achieved an extremely low detection limit (LOD) of 0.66 cfu/mL and showed a wide linear range (2.9 cfu/mL to 2.9 × 10(6) cfu/mL).N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1125 334186732018Fast and Sensitive Detection of Salmonella in Milk Samples Using Aptamer-Functionalized Magnetic Silica Solid Phase and MCM-41-Aptamer Gate SystemS. enterica specific aptamerTATGGCGGCGTCACCCGACGGGGACTT27N/AssDNASalmonella EntericaWhole cellDeveloped an aptamer-gated MCM-41 silica system (Fe3O4@SiO2@pGMA and MCM-41 particles) to detect S. enterica in food samples.The linear range is from 2000 CFU/mL to 104 CFU/mL in milk, with the LOD of 2336 cells.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1719 349864392022Potentiometric aptasensing of Escherichia coli based on electrogenerated chemiluminescence as a highly sensitive readoutAptamerGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG36N/AssDNAEscherichia Coli (E. Coli) O157: H7Whole cellDeveloped a potentiometric aptasensor by electrogenerated chemiluminescence (ECL) using SWCNTs-aptamer modified electrode to detect E. coli.Shows a highly sensitive response to E. coli O157: H7 in the linear range of 5-1000 CFU/mL with a low detection limit of 2 CFU/mL.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A
ABdb_1774 372441922023High-throughput, highly sensitive and rapid SERS detection of Escherichia coli O157:H7 using aptamer-modified Au@macroporous silica magnetic photonic microsphere arrayAptamerTGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC45N/AssDNAEscherichia Coli (E. Coli) O157:H7 (CICC 21530)Whole cellAn aptamer-Au@MMSPM SERS array biochip method was developed for the detection of E. coli O157:H7.Gave a wide linear detection range (10–10(6) CFU/mL) and low limit of detection (2.20 CFU/mL) for E. coli O157:H7.N/AN/AN/ABiosensorN/A5'-Thiolated (SH-C12) (of Aptamer 1) and 3'-Amidation (NH₂-(CH2)6) (for Aptamer 2)N/AN/AN/AN/AN/A
ABdb_1927 394060882025Laser-induced graphene-based aptasensor for the selective detection of Escherichia coli in urine samplesP12-55CATACGATTTAGGTGACACTATAGCCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGAATTTCTCCTACTGGGATAGGTGGA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922)Whole cellDeveloped an impedance biosensor using a Laser-Induced Graphene-based (LIG) electrode for the detection of E. coli in urine samples.The aptasensor showed a linear response to E. coli over the range 10(0)-10(3) CFU/mL and LOD of 9 CFU/mL in PBS.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂-(CH2)6)N/AN/AN/AN/AN/A