AptBacterialDB

Modification : 3'-Amidation (NH₂)

Total records found: 12

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0427 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE1GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A12.4 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0428 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE2GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A25.2 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0429 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE10GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA90N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A14.2 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0773 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE1GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Whole cellComposite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy12.4 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0774 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE2GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Whole cellEnhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy25.2 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0775 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE10GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA90N/AssDNAEscherichia Coli (E. Coli)Whole cellEnhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy14.2 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0823 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 3GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates.14Fluorescence Spectroscopy41 ± 2 nMTherapeuticsWhole Cell-SELEX3'-Amidation (NH₂) and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0934 278258862017Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detectionE.coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 8739)Whole cellUpconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk.Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1279 316173472019Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color EmissionS. aureus aptamer (Apt)GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellAn ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus.The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1540 346649412021Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite SheetsS. Typhimurium aptamer (ST-NH2)TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG52N/AssDNASalmonella Typhimurium (S. Typhimurium) (CMCC 50115)Whole cellICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium.Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂)ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities.N/AN/AN/AN/A
ABdb_1548 343960092021DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid KillingMRSA aptamerATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA755'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Whole cellApt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation.Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2).N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) and 5'-FITC LabeledThe aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination.N/AN/AN/AN/A
ABdb_1926 401369432025Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in FoodP. aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa PAO1Whole cellDeveloped a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs.Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A