Modification : 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0776	27871171	2016	Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats	Ec3 (31) -Truncated	UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG	31	5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'	ssRNA	Escherichia Coli (E. Coli) DH5α	Whole cell	Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.	Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells.	12	Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)	225 nM	Biosensor	Whole Cell-SELEX	2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled	N/A	N/A	N/A	N/A	N/A