AptBacterialDB

Modification : 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated

Total records found: 4

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0776 278711712016Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection FormatsEc3 (31) -TruncatedUUCAAUUGCACGAAUUUGCUGUGUUUUUGGG315'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssRNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells.12Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)225 nMBiosensorWhole Cell-SELEX2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) LabeledN/AN/AN/AN/AN/A
ABdb_0777 278711712016Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection FormatsEc3AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU765'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssRNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.N/A12Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ABiosensorWhole Cell-SELEX2'-Fluoro pyrimidines (2'-F-RNA) or 3'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0778 278711712016Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection FormatsEc2AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU745'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssRNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.N/A12Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ABiosensorWhole Cell-SELEX2'-Fluoro pyrimidines (2'-F-RNA) or 3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0779 278711712016Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection FormatsEc5AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU775'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssRNAEscherichia Coli (E. Coli) DH5αWhole cellIdentify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays.N/A12Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ABiosensorWhole Cell-SELEX2'-Fluoro pyrimidines (2'-F-RNA) or 3'-BiotinylatedN/AN/AN/AN/AN/A