AptBacterialDB

Modification : 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0090 221662022011In vitro selection of Escherichia coli O157:H7-specific RNA aptamerTwo Arm ( from clone I-1)GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA645'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'ssRNAEscherichia Coli (E. Coli) O157:H7(ATCC 43895)Whole cellIdentify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain.6Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)~110 nMDetectionSubtractive SELEX2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'N/AN/ABest CandidateN/AN/A
ABdb_0091 221662022011In vitro selection of Escherichia coli O157:H7-specific RNA aptamerClone I-1GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU995'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'ssRNAEscherichia Coli (E. Coli) O157:H7(ATCC 43895)Whole cellIdentify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.Bound to the E. coli O157:H7 strain 2.8-fold better than the control.6Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSubtractive SELEX2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'N/AN/AN/AN/AN/A
ABdb_0092 221662022011In vitro selection of Escherichia coli O157:H7-specific RNA aptamerClone III-2GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU995'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3'ssRNAEscherichia Coli (E. Coli) O157:H7(ATCC 43895)Whole cellIdentify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli.Bound to the E. coli O157:H7 strain 2.3-fold better than the control.6Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSubtractive SELEX2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3'N/AN/AN/AN/AN/A