Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 40
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0073 | 19505816 | 2009 | A sensitive method to detect Escherichia coli based on immunomagnetic separation and real-time PCR amplification of aptamers | E. coli specific RNA aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop an aptamer-based, antibody-conjugated magnetic-bead sandwich assay to detect E. coli. | Showed a wide dynamic range from 10¹ to 10(7) E. coli per ml and achieved a detection limit of 10 E. coli in a 1 ml sample. | N/A | N/A | N/A | Biosensor | N/A | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0075 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C11 | GGGAGGAGGAGAGAUGUGAACUU-AUUCGGGCCCAGGAACCAACUAUAUAAAUGUCCCGAAUGCUUCGACG-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 304 ± 13 nM and KI' of 163 nM for C11. | 9 | Nitrocellulose Filter Retention Assay | 186 ± 18 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0076 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C12 | GGGAGGAGGAGAGAUGUGAACUU-ACAACCCGGAACAACGUCUAACAGUGUACCAUAACCCGGCAUUCA-AGAAACUCUACACUGGACUGGCG | 91 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 66 ± 2 nM and KI' of 525 nM for C12. | 9 | Nitrocellulose Filter Retention Assay | 111 ± 12 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0077 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C22 | GGGAGGAGGAGAGAUGUGAACUU-GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 214 ± 9 nM and KI' of 603 nM for C22. | 9 | Nitrocellulose Filter Retention Assay | 87 ± 20 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0090 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Two Arm ( from clone I-1) | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | ~110 nM | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0091 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone I-1 | GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.8-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0092 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone III-2 | GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.3-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0446 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mA_Apt1 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mA_Apt1 (~40% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | Best Candidate | N/A | N/A |
| ABdb_0447 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mB_Apt23 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mB_Apt23 (~20% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0448 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mC_Apt41 | CACAGCGGGACAGUUUAGC-CAGGCUGUUCUGACGCAUAAGGAAUGCGCUGUUGCAGAG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | mC_Apt41 neutralized 0.007 pmole of Stx2 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0449 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mD_Apt46 | CACAGCGGGACAGUUUAGC-UUGGUCCUGCUUUGGAUAGUCGCGAAAGGGGUGCCACUG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0450 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pA_Apt1 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0451 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pB_Apt14 | CACAGCGGGACAGUUUAGC-ACCGAGCGGUUUUACGUCUCAAGUAGUAUCCCGUUUUGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0452 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pC_Apt22 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer pC_Apt22 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0453 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pD_Apt25 | CACAGCGGGACAGUUUAGC-UUGCCAUCCUGUACUAUGCUCUAUCGGGCGGUUUAGUGAUCCUUCGUCCAACUAUC-GGUAGGUGGGUGCGUCUAAA | 95 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0776 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 (31) -Truncated | UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG | 31 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 225 nM | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0777 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 | AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0778 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec2 | AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU | 74 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0779 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec5 | AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1038 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A011 | CCAAGCUUGCAUGCCUGCAG-GGACUGUGGAUUGUUCUGGGUGCCGCUUCUCCGAAUAUCGGACUCUCGAACUCCUGGGGA-GGUACCGAGCUCGAAUUCCC | 100 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | 267 ± 48 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1039 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A036 | CCAAGCUUGCAUGCCUGCAG-GAUAUACGGUGCCGCUUCUCUAACCGGUGGUCAUGCGGUUGGACGCUCGAACAGACUA-GGUACCGAGCUCGAAUUCCC | 98 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1608 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su12 | GGGAGUCGACCGACCAGAA-CAUACUGAGUAAGAUCGGAAAUUUCGGUGUAAGGCCACGG-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | Significantly reduced biofilm formation by 61.2%. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1609 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su057 | GGGAGUCGACCGACCAGAA-UGGAUGUAUGGAACUUGCAGAUCUUAACUGCACGAAGCGU-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1610 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su15 | GGGAGUCGACCGACCAGAA-ACACGUUGCUGAAACAUACCGAGUAACAUAAAGCGGGUG-UAUGUGCGUCUACAUCUAGACUCAU | 83 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |