Modification : *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled

Total records found: 1

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0964 289878792017Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in miceCD44 Thioaptamer (CD44TA)GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC74N/AssDNAMycobacterium Tuberculosis (M.Tb.)CD44 receptor (Mtb-infected murine macrophages)Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs.CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control.N/AN/AN/ATherapeuticsN/A*= 5'-monothio-dA and 5'-Cyanine5 (Cy5) LabeledIn uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability.N/AN/AN/AN/A