Method : Whole Cell-SELEX with the High-Throughput Sequencing (HTS)

Total records found: 18

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1075	35547676	2018	Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system	PA1	TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC	84	5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa.	Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL.	12	N/A	15.16 ± 3.62 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	N/A	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1076	35547676	2018	Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system	PA2	TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC	84	5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa.	N/A	12	N/A	14.11 ± 2.59 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1077	35547676	2018	Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system	PA3	TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC	84	5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa.	N/A	12	N/A	32.59 ± 8.89 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1078	35547676	2018	Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system	PA4	TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC	82	5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa.	N/A	12	N/A	16.39 ± 8.14 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1079	35547676	2018	Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system	PA5	TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC	80	5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'	ssDNA	Pseudomonas Aeruginosa (ATCC 27853)	Whole cell	Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa.	N/A	12	N/A	30.69 ± 7.15 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	N/A	N/A	N/A	N/A	N/A	N/A
ABdb_1856	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	Ab1 (A00)	TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC	80	5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	14.12 ± 2.31 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1857	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	Ab2	TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC	80	5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	26.26 ± 9.87 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1858	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	Ab3	TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC	80	5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	66.51 ± 24.28 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1859	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	Ab4	TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC	80	5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	97.98 ± 37.42 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1860	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	Ab5	TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC	80	5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3'	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	142.2 ± 39.3 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1861	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	A01	GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG	58	N/A	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	27.91 ± 13.34 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1862	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	A02	GAGCGGGCGACTCCGGGAGATCGCGCGCGG	30	N/A	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium.	12	Fluorescence Binding Assay	6.86 ± 5.77 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1863	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	A03	CGACTCCGGGAGATCG	16	N/A	ssDNA	Aliarcobacter Butzerli (ATCC 49616)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	19.33 ± 9.76 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1864	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	C00	GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA	77	N/A	ssDNA	Campylobacter Jejuni (ATCC 33560)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	48.12 ± 6.15 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1865	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	C01	CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG	38	N/A	ssDNA	Campylobacter Jejuni (ATCC 33560)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium.	12	Fluorescence Binding Assay	27.69 ± 5.66 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	Best Candidate	N/A	N/A
ABdb_1866	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	C02	CGCGAGTCTGCTGTCAATCGCAAGGCGCG	29	N/A	ssDNA	Campylobacter Jejuni (ATCC 33560)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	61.58 ± 19.805 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1867	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	C03	CGCTGTCAATCGCG	14	N/A	ssDNA	Campylobacter Jejuni (ATCC 33560)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	240.2 ± 106.85 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1868	37619471	2024	A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter	C04	GCGTCCATGTCGC	13	N/A	ssDNA	Campylobacter Jejuni (ATCC 33560)	Whole cell	Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.	N/A	12	Fluorescence Binding Assay	259.8 ± 55.1 nM	Biosensor	Whole Cell-SELEX with the High-Throughput Sequencing (HTS)	5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A