Method : Sequential Toggle Cell-SELEX (STC-SELEX)

Total records found: 35

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0982 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-01CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0983 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-02CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0984 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-03CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis.18Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis)DetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0985 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-04ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC395'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0986 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-05CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC385'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0987 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-06GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0988 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-07GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0989 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-08GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0990 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-09GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0991 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-10AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0992 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-11AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0993 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-12GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.STC-12 showed better affinity to E. coli and S. epidermidis.18Micro-Fluorospectrophotometer (Fluorescence Spectroscopy)38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis)DetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/ABest CandidateN/AN/A
ABdb_0994 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-13GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT405'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0995 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-14CGGGGTGGGACCAGTCTTGCGCGGGTGAC295'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0996 282725542017Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEXSTC-15GGACTGGAGTCTAGACCGGGTAGCTGTGGT305'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3'ssDNAEscherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917)Whole cellIdentify aptamers with broad affinity for bacteria across different genera.N/A18N/AN/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1282 315116142019Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamersGN6ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT765'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAGram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens)Whole cellIsolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria.Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively.12Fluorescence Binding Assay29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens)DetectionSequential Toggle Cell-SELEX (STC-SELEX)5'-Biotinylated and 3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1283 315116142019Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamersGN12ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT765'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAGram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens)Whole cellIsolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria.GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested.12Fluorescence Binding Assay20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens)DetectionSequential Toggle Cell-SELEX (STC-SELEX)3'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1680 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K3CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)36,70 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1681 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K4CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1682 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K6CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.S15K6 has the highest binding affinity to S. aureus BPA-12.15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)17,01 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/ABest CandidateN/AN/A
ABdb_1683 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K13CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)60,69 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1684 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K15CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)20,90 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1685 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K20CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStaphylococcus aureus (S. aureus) BPA-12Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1686 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K3CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEscherichia Coli (E. Coli) EPEC 4Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)28,06 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1687 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K4CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEscherichia Coli (E. Coli) EPEC 4Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1688 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K6CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEscherichia Coli (E. Coli) EPEC 4Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)31,99 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1689 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K13CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEscherichia Coli (E. Coli) EPEC 4Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.S15K13 and S15K15 have high binding affinity to E. coli EPEC 4.15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)5,21 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/ABest CandidateN/AN/A
ABdb_1690 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K15CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEscherichia Coli (E. Coli) EPEC 4Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.S15K13 and S15K15 have high binding affinity to E. coli EPEC 4.15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)8,89 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/ABest CandidateN/AN/A
ABdb_1691 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K20CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAEnteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1)Whole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1692 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K3CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.S15K3 and S15K13 have a high binding affinity for S. agalactiae.15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)6,84 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/ABest CandidateN/AN/A
ABdb_1693 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K4CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1694 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K6CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)20,79 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1695 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K13CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.S15K3 and S15K13 have a high binding affinity for S. agalactiae.15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)6,53 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/ABest CandidateN/AN/A
ABdb_1696 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K15CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)45,36 nMDetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A
ABdb_1697 357763862022A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteriaS15K20CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG815'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3'ssDNAStreptococcus AgalactiaeWhole cellIsolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli.N/A15Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionSequential Toggle Cell-SELEX (STC-SELEX)N/AN/AN/AN/AN/AN/A