Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 7
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |