Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1461
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0001 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10_65 | GACGTCTTCGAATCCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTG | 65 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | 200 ± 20 (against short SEB peptide) and 420 nM (Full length SEB protein) | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0002 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10 | TCAGCTGGACGTCTTCGAAT-CCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTCATCATCTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0003 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12a10 | TCAGCTGGACGTCTTCGAAT-TACCAAGGTGTACGAGCGGCATTGGCTTAGGATGGTCTAGGAGAACGCCTTGTTCACGGG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0004 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12d10 | TCAGCTGGACGTCTTCGAAT-GGGCATTGGCTAGGACGGTCTAGCAGGAGAAGATGTTAAGTGTGCCTTAGTCAGAGAGTG-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0005 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12e7 | TCAGCTGGACGTCTTCGAAT-GGGTATAGTGTCTGGCATTGGCGAGGATGGTCTCAAACGCTAAACCCAATCTGTATAACA-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0006 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8c3 | TCAGCTGGACGTCTTCGAAT-CGTGGGCATCGGGCTGCATGAATGGCATTGGCGAGGAGGGTGTGTTTGTAGGCAGCACCT-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0007 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | AE11a5 | TCAGCTGGACGTCTTCGAAT-ACCCGTACAGTCCTATGTTGGCATCCTCACTTGTGGCATTGGCAAGGATGGTCTTCTAG-TGTCAGGAGCTCGAATTCCC | 99 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0008 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | A8g1 | TCAGCTGGACGTCTTCGAAT-GCTCGACAGGGCACCACCGCCTCGGCATTGGCTAGGTTGGTCTCTTTGGCGGGGTTGCGC-TGTCAGGAGCTCGAATTCCC | 100 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | N/A | N/A | N/A |
| ABdb_0009 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F1-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-ACUGUCCUCCCUUCAGAGAGCGCGGGACCCUUAACUUGGGGCCCACGAACAGCUUCAGUUCCGUCUCGGCGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 140 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F1-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 2 ± 11 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0010 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F2-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-UCCCUGGCCCAAGAUCCUAAUAAAGUUUUUUCGGACCGGAGCGAAACCACUAUCCUCUUAAGCAAUCUGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F2-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 14 ± 2 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0011 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F3-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUACAACACAUCAUUACGGCUGCUAUUGGCUCCAAGCGUCUUUCUCCCUGGUCAAUAGUCCAGCCACCACG-CAUAUGUGCGUCUACAUGGAUCCUCA | 139 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 4 ± 15 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0012 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGAGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 7 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0013 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F5-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUCAGCUGCUCGCGGGAUCGAUCCAUUCGGUGGCCAUGCUCCGGAAGAGGCUUCGCAAGACUCAGG-CAUAUGUGCGUCUACAUGGAUCCUCA | 134 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 10 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0014 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-2 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGGGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 294 ± 170 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0015 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.4 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UCACUGUUAUCCGAUAGCAGCGCGGGAUGA-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | 2.0 μg of RNA aptamer S-PS8.4 effected ca. 71% inhibition of cell invasion by pil+ S. enterica serovar Typhi A21-6 but only ca. 19% inhibition in the case of the pilS::Kmr mutant. | 8 | Nitrocellulose Filter Binding Assay | 8.56 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0016 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.3 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AUUACCUAGAGCGGGAUAAAGUAUAGGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0017 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.2 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-CAUCGAGGAGGCGGGAUAUUCGAUGAGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0018 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.5 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAGUACGAGCGGGAUAGUAAUCGGGUGAU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0019 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.6 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAAGGGGUCCGGCUCGGGUGAGGGUCGGGU-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0020 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.9 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AGCUAGCGGGGGGGCUCGACGGUGGUGGGUU-GGGUCAAUGCGUCAUA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0021 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.7 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UAGCGGGAGCUUGGACCUGGUGGUCGCGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0022 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.1 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UUGGGAUCAGCUCGGCGCUGGAGGAGGGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0023 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.8 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AACUGUACAUGGGCGCAACAGGGAGUUAGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0024 | 17188871 | 2007 | In vitro selection of RNA aptamer against Escherichia coli release factor 1 | Class II-1 | GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC | 85 | N/A | ssRNA | Escherichia Coli (E. Coli) | Release factor 1 (RF-1) | Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression. | Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%). | 11 | Surface Plasmon Resonance (SPR) | 30 ± 6 nM | Therapeutics | SELEX | 3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0025 | 17265180 | 2007 | Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores | Aptamer | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | 60 | N/A | ssDNA | Bacillus Thuringiensis (BT) | BT spores | Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores. | Limit of detection (LOD) between 10³ and 10(4) CFU. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0042 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1P | AGCAGCACAGAGGTCAGATG-TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTG-CCTATGCGTGCTACCGTGAA | 78 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | The number of aptamer molecules binding to each cell (on average, ∼164 ± 47 aptamer molecules per cell). | 8 | Flow Cytometry | 13 ± 3 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0043 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1 | TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGATG | 39 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0044 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1 | TGAGCCCCACTAAAGTTGCAATCATGTCGTCAGCTTTGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0045 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3 | CGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0046 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1P | AGCAGCACAGAGGTCAGATG-TGAGCCCCAGTAAAGTTGCAATCATGTCGTCAGCTTTGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0047 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3P | AGCAGCACAGAGGTCAGATG-TCGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG-CCTATGCGTGCTACCGTGAA | 81 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0048 | 18214875 | 2008 | Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli. | The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min. | N/A | N/A | N/A | Detection | SELEX | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0058 | 19751419 | 2009 | Antibiotic resistance in bacteria: novel metalloenzyme inhibitors | Metallo-β-lactamase-targeting aptamers | CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC | 61 | 5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3' | ssDNA | Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56 | Metallo-β-lactamase active sites | Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme. | LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively. | 21 | Metallo-β-lactamase activity assays | Ki = 0.92 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0059 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 19 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment. | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0060 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 18 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0061 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 31 | TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG | 81 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0062 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 14 | TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG | 82 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0063 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 25 | TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG | 73 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0064 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 43 | TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG | 83 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0065 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | M64CA (aptamers 20, 34, 41, 46, and 50 ) | GGGAGCTCAGAATAAACGCTCAA-TTCGGGAATGATTATCAAATTTATGCCCTCTGAT-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0066 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | Aptamer 11 (named M64RA) | GGGAGCTCAGAATAAACGCTCAA-TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0067 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 33 | TTTGGTCCTTGTCTTATGTCCAGAATGC-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | In a pull-down assay format, detection limits were 10¹–10² CFU S. Typhimurium/9 mL rinsate, while in a recirculation format, detection limits were 10²–10³ CFU/25 mL rinsate. | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0068 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 23 | TTTGGTCCTTGTCTTATGTCCAGAATGC-CCGCCTTTACTAAATTGACGAACATAGGAATCAATGAAGC-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0069 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 24 | TTTGGTCCTTGTCTTATGTCCAGAATGC-GGGAGTCAGAACGCCTGGGCAAGCATAGTACTCGCCGGAA-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0070 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 25 | TTTGGTCCTTGTCTTATGTCCAGAATGC-TAAAGAGGAATCGACAGGCATCAGAGTCCGTAATGCGGGG-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0071 | 19049862 | 2009 | Selection, characterization, and application of DNA aptamers for the capture and detection of Salmonella enterica serovars | Aptamer 45 | TTTGGTCCTTGTCTTATGTCCAGAATGC-GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA-ATTTCTCCTACTGGGATAGGTGGATTAT | 96 | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) DT104 | Outer membrane protein (OMP) | Identify aptamers that capture and detect Salmonella enterica serovar. Typhimurium. | N/A | 7 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0074 | 19234874 | 2009 | Aptamer-based electrochemical biosensor for Botulinum neurotoxin | BoNT/A aptamer | ATACCAGCTTATTCAATTGACATGACTGGGATTTTTGGCGAAATCGAAGGAAGCGGAGAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) toxoid | Developed an aptamer-based electrochemical sensor for the detection of Botulinum neurotoxin. | Achieved a limit of detection (LOD) of 40 pg/ml within 24 h. | N/A | N/A | 3.0 ± 0.8 × 10(9) M−1 | Biosensor | Single micro-bead SELEX | 5'-Biotinylated and 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0075 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C11 | GGGAGGAGGAGAGAUGUGAACUU-AUUCGGGCCCAGGAACCAACUAUAUAAAUGUCCCGAAUGCUUCGACG-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 304 ± 13 nM and KI' of 163 nM for C11. | 9 | Nitrocellulose Filter Retention Assay | 186 ± 18 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0076 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C12 | GGGAGGAGGAGAGAUGUGAACUU-ACAACCCGGAACAACGUCUAACAGUGUACCAUAACCCGGCAUUCA-AGAAACUCUACACUGGACUGGCG | 91 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 66 ± 2 nM and KI' of 525 nM for C12. | 9 | Nitrocellulose Filter Retention Assay | 111 ± 12 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0077 | 20452328 | 2010 | In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin | S132B-C22 | GGGAGGAGGAGAGAUGUGAACUU-GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC-AGAAACUCUACACUGGACUGGCG | 93 | 5'-GGGAGGAGGAGAGATGTGAACTT-N47-AGAAACTCTACACTGGACTGGCG-3' | ssRNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) | Identify aptamers against the light chain of type A BoNT (BoNT/A) and inhibit the endopeptidase activity. | IC50 values of 214 ± 9 nM and KI' of 603 nM for C22. | 9 | Nitrocellulose Filter Retention Assay | 87 ± 20 nM | Therapeutics | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and Radiolabelled ([α-33P]-GTP labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0080 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 4R | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | Detect as few as 30 live, unlabeled E. coli per ml using FRET assay. | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0081 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 3R | ATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0082 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 8F | ATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT | 72 | 5'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0083 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence A | GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT | 76 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0084 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence B | CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC | 149 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0085 | 21381755 | 2011 | Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2 | PPK2 G9 | CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-AACACATAGGTTTGGTTAGGTTGGTTGGTTGAATTA-AAGCTTTGCAGAGAGGATCCTT | 99 | 5'-CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-N35-AAGCTTTGCAGAGAGGATCCTT-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | PPK2 Enzyme | Identify aptamers that bind to and inhibit the catalytic activities of enzyme PPK2. | Inhibited PPK2 protein with an IC50 of 39.3 ± 10 nM and inhibited the NDK activities of both the LHK and VC PPK2 proteins with IC50 values of >1 μM and 105 ± 5 nM, respectively. | 20 | Isothermal Titration Calorimetry (ITC) | 870 ± 220 nM | Therapeutics | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0086 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 19 | CGTACGGTCGACGCTAGC-GGCGACCCCCGGGCTACCAGACAATGTACGCAGCAAGAGTGACGGTCGTACCTCGGAGTC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 44 ± 7 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0087 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 31 | CGTACGGTCGACGCTAGC-ACACTCTTTTGCTCGTGTTTTTGCCTGTTACATAAAATGAATCAGTGGATGTTTCCTTCT-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 36 ± 8 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0088 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 7 | CGTACGGTCGACGCTAGC-GGCGGCCGTGAAATTTGCCAAATGCCGTCTTGGCTTTCGCCCAATGTATCCTGGGTGTTC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | N/A | 11 | Fluorescence Spectroscopy | 43 ± 6 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0089 | 21627466 | 2011 | Aptamer selection for the detection of Escherichia coli K88 | Aptamer 37 | CGTACGGTCGACGCTAGC-GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC-CACGTGGAGCTCGGATCC | 96 | 5'-CGTACGGTCGACGCTAGC-N60-CACGTGGAGCTCGGATCC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | Identify aptamers that bind to and detect the K88 fimbriae protein of E.coli K88 surface protein. | Fluorescence intensity of other bacteria (ETEC K99, S. aureus, E. coli TOP10) is lower than that of ETEC K88. | 11 | Fluorescence Spectroscopy | 25 ± 4 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0090 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Two Arm ( from clone I-1) | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | ~110 nM | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0091 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone I-1 | GGGAUACCAGCUUAUUCAAUU-UGAUUCCAUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAU-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.8-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0092 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Clone III-2 | GGGAUACCAGCUUAUUCAAUU-CGCACUGUUUUGCCCAGCCGUGUGAAAUUGAUUAGACGUUUUGUAUGCGAUUUCGCCUUG-AGAUAGUAAGUGCAAUCU | 99 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Bound to the E. coli O157:H7 strain 2.3-fold better than the control. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_0093 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A24P | AGCAGCACAGAGGTCAGATG-GGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGG-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A24P forms a branched structure with high affinity for the target cell mixture (gated fluorescence intensity above library of 64%). | 20 | Flow Cytometry | 9.1 ± 0.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0094 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 15A3P | TTCACGGTAGCACGCATAGG-GACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | Show a gated fluorescence above the background of 48%. | 20 | Flow Cytometry | 9.6 ± 0.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0095 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1 | CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0096 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1P | TTCACGGTAGCACGCATAGG-CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0097 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8 binding to the target GAS cells yielded 72% gated fluorescence above background. | 20 | Flow Cytometry | 4 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0098 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8P | AGCAGCACAGAGGTCAGATG-CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8P binding to the target GAS cells yielded 68% gated fluorescence above background. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0099 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 65% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0100 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9P | AGCAGCACAGAGGTCAGATG-CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG-CCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 66% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9.1 ± 0.6 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0101 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A12P | TTCACGGTAGCACGCATAGG-GCCCGACACTCGTCCACCCGATACCTCTCATGTGTCCC-CATCTGACCTCTGTGCTGCT | 78 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 25 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0102 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A14P | AGCAGCACAGAGGTCAGATG-GGCATGGGGAAGAGAAAGCGGGATAACTTCGTTACCGGGC-CCTATGCGTGCTACCGTGAA | 80 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | N/A | 20 | Flow Cytometry | 17 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0103 | 21743920 | 2011 | Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties | 1–PA | GCGCGGATCCCGCGC-GATGTGGGTGTAGTTGGAGGGTAAACGTT-CGCGCGAAGCTTGCG | 59 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Protective antigen (PA) of anthrax toxin | Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex. | The limit of PA detection using this system was determined to be approximately 1 nM. | 8 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 8.53 nM | Biosensor | SELEX | N/A | N/A | N/A | N/A | N/A | Korea Pat., KR101152354B1 (2012-06-13) |
| ABdb_0104 | 21743920 | 2011 | Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties | 2–PA | GCGCGGATCCCGCGC-CAGACCGTAAGGGATGCCGCCTAAACACC-CGCGCGAAGCTTGCG | 59 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Protective antigen (PA) of anthrax toxin | Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex. | The limit of PA detection using this system was determined to be approximately 1 nM. | 8 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 1.51 nM | Biosensor | SELEX | N/A | N/A | N/A | N/A | N/A | Korea Pat., KR101152354B1 (2012-06-13) |
| ABdb_0105 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | F23 showed great specificity to P. aeruginosa and no cross-reactivity with other bacterial species. | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0106 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F12 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTTGCTTTTGTTCGCTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0107 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F8 | ATACCAGCTTATTCAATT-CCGTGGCGTTCTGTTTGTTCGTTGTTTTTTGGTTTTTCCTTCTTTTTTTGTTTTTGGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0108 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F1 | ATACCAGCTTATTCAATT-GGCGCGCGTTGTGTGGTTTGGCTTTTTTCGTTTGTTTTTCTTGGGTGCTTGTCTTCGTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0109 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F20 | ATACCAGCTTATTCAATT-CCCTCGCCGTACGTTCTCCGTTTTGTCAGGTGTTGTTTTTTCCGTCCTCTTCTCGTGTGC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0110 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F4 | ATACCAGCTTATTCAATT-CCACCGATTCCCTTCGATCGTATTCGTGTTGCTCTCGTGTTGTAATGCGTCCTGTGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0111 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F6 | ATACCAGCTTATTCAATT-GGCACCGGCTTGTCTGTTTCTCTTGGTTCGCCGCTGGACTTTGTTAGCTCCCTCCGCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0112 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F7 | ATACCAGCTTATTCAATT-CCCCACAACCTGACCTTTCTATTCCGTTCCCCTTTTTTCAGCTTCTTTCCGGCCTCTGTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0113 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F18 | ATACCAGCTTATTCAATT-CCACCACCGGGTTGTTTTTCCTGCAGGCCTTTATCGTTTTCCGCGCTCGATTCGGTCATG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0114 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F5 | ATACCAGCTTATTCAATT-CCACCGTGCTTTATATTACCCGTCCACCCTTCGGTCTTTCTCCCCGTGTCGCTCCGCTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0115 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F21 | ATACCAGCTTATTCAATT-CCACCGGGCCTCGTATTCGTACTGTTTGATTCTTTGGCTTTGTAGCGGACGTACTGGGTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0116 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F2 | ATACCAGCTTATTCAATT-CCCCCGCGCCCGTCTCTCTCAATCTCCGCATTCTTTAGTTCTCATCCTCCCTGTGTGTTT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0117 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F24 | ATACCAGCTTATTCAATT-GACACCCGGAGTAATTCCGTTTTAAGCGTCTTTCATGTGTTCCCTTTCGTTCCTCCCTTG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0118 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F15 | ATACCAGCTTATTCAATT-CCCAAGGTCGAGTTCCTAGTCTTACCGTATTTCACTTTCCTGGTTCTTACCTCCCCCTCA-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0119 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F22 | ATACCAGCTTATTCAATT-CGGCGCGAGTCGACTGCACAGGGTCCTATTGCTTATGGTCATGGTTTCGTTTCATCCTCG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0120 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F16 | ATACCAGCTTATTCAATT-CCCGCGATATGACCATCCAGCTGCTCCTCTGTTATTGTTGGTTTTCCTGTTTTCCTTTGT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0121 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F17 | ATACCAGCTTATTCAATT-CCCCAGTGCTCAGCTTCTCCTCCGTCTCATTCTTCTGTAGGATCGTTCTGTTTTGGTACT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | 57.63 ± 11.64 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0122 | 20936492 | 2011 | Utility of aptamer-fluorescence in situ hybridization for rapid detection of Pseudomonas aeruginosa | F10 | ATACCAGCTTATTCAATT-CCCACCGTCCTCGTGCTTAGTCTTTATGTTTCGTCCTTTTCTTTCTTCGTTCTGTCGCCT-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-60N-AGATAGTAAGTGCAATCT-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify aptamers that specifically bind to and develop a rapid FISH assay to detect P. aeruginosa. | N/A | 15 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0134 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6F | ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0135 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6R | ATCCGTCACACCTGCTCT-GCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGGA-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0138 | 22520654 | 2012 | Evaluation of the clinical value of ELISA based on MPT64 antibody aptamer for serological diagnosis of pulmonary tuberculosis | MPT64-A1 | GGGAGCTCAGAATAAACGCTCAAA-GGGAGCTCAGAATAAACGCTCAAAAACGCTCAAGAGGCCCGGATCTTCGACATGAGGCCCGGATC-CGACATGAGGCCCGGATC | 107 | 5'-GGGAGCTCAGAATAAACGCTCAAA-N35-CGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 antibody | Identify aptamers against MPT64 antibody and develop a sandwich ELISA for the serological diagnosis of pulmonary TB (PTB). | LOD was 2.5 mg/L, with a linear range varying from 10 mg/L to 800 mg/L. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0147 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B1 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | Achieved a linear detection range of 0.01 to 1 ng/mL of LPS with a detection time of less than 15 minutes. | 3 | Surface Plasmon Resonance (SPR) | 20 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0148 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B2 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 12 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0149 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B3 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGTTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 32 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0150 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B4 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 21 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0151 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B5 | CTTCTGCCCGCCTCCTTCC-CTAAGCACAGGGAAACCAGCTAATGAGTTAGGCCTGTCCCCCACG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 484 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0152 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B6 | CTTCTGCCCGCCTCCTTCC-CAATGGACCTATTCGAGTACTGAATAGAACAGTCGGCGCTCTGGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 298 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0153 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B7 | CTTCTGCCCGCCTCCTTCC-TTCAAGACGATGCCTGGCGCGAGTTACACACTTGCATGGAGCTGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 61 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0154 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B8 | CTTCTGCCCGCCTCCTTCC-ATCCAATACCTCAGAACTCAGTTCGAGTCGTAAAGGGGAATCGCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 71 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0155 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B9 | CTTCTGCCCGCCTCCTTCC-ACCGATCCATCGAGTTTCTGAGAAAGGCCCGGAGAAACCGCGAGA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 15 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0156 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B10 | CTTCTGCCCGCCTCCTTCC-TCAATCTAACCATGCATGCAGTTTAGGCAGGATTCGTTATCGCAA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 2336 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0166 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E06 | TGATCCGGGCCTCATGTCGAACCCACACCCCACAACCACCCAGCCCCAGCCCGCTATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0167 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F04 | TGATCCGGGCCTCATGTCGAACACAACACCCAGCCAACGACCACAACTCCAACTCATTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0168 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C10 | TGATCCGGGCCTCATGTCGAAACCACAACCCAACAACAAGAACCACAAAGAGCCCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0169 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B06 | TGATCCGGGCCTCATGTCGAACACACACAGAACCACAACCACTAAACACGAGGGCCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0170 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B10 | GATCCGGGCCTCATGTCGAACACCCCCCAACTAAAACAACAAAACACCACCGCCATTGAGCGTTTATTCTGAGCTCCCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | Digoxigenin-B10 bound to the Salmonella O8 target with high specificity, producing a clear fluorescent signal within 1.5–2 h. | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 32.04 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0171 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C04 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0172 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F05 | TGATCCGGGCCTCATGTCGAACCAACAAGGCAGAAAGAAACCGACAAACCGCACTGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0173 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | B05 | TGATCCGGGCCTCATGTCGAACCGAACGACTCAAAGATCAAGCCAAGCCACGCCCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0174 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G05 | TGATCCGGGCCTCATGTCGAACCAACCCAACACCAAAGAGACCACCACCACACGAGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 175.9 nM | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0175 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D04 | TGATCCGGGCCTCATGTCGAACACGAGCCACCAACGCACCAAAACCCGTCCTCCACTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0176 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | E04 | TGATCCGGGCCTCATGTCGAAGGCACGCGCACCAAAACACAAACTCCCCCCGCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0177 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | G06 | TGATCCGGGCCTCATGTCGAAGGGCCACCTAACCACCTCTGCCAATACCCCCCGCGTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0178 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C05 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0179 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | C06 | TGATCCGGGCCTCATGTCGAAGGGAAGTCATGGCATGGATGCGCTCCCCGCCCACCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0180 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H05 | TGATCCGGGCCTCATGTCGAACGGCGCAGTGACACGGTAGGGAGTCGTGCCGCGGCTTGAGCGTTTATTCTGAGCTCCCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0181 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | H06 | TGGGAGCTCAGAATAAACGCTCAAGGTGGGCGGGCGGCGTTGCTGTTCTTTTGCTGGTGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0182 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | F06 | TGGGAGCTCAGAATAAACGCTCAAGAGGCGGCCTGTTCGCTTGTTGTGGGTCCGCTTGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0183 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | A05 | TGGGAGCTCAGAATAAACGCTCAAGGGCACTGGGTGGTGATGTTTTGTTTGTCTGGCGGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0184 | https://doi.org/10.1007/s00604-012-0825-2 | 2012 | Screening and preliminary application of a DNA aptamer for rapid detection of Salmonella O8 | D06 | TGGGAGCTCAGAATAAACGCTCAAGGGGGGGGTGGAGGGGTATGCAGTTTCGGTGGCCGTTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Salmonella O8 | Whole cell | Identified aptamers for the detection of Salmonella O8. | N/A | 11 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0187 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-1 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0188 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-2 | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0189 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-3 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0190 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-4 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0191 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-5 | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0192 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-6 | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0193 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-7 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0194 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-8 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0195 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-9 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | Can successfully detect S. enteritidis down to 600 CFU/mL (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-6-hydroxyhexyl disulfide group (5'-/5ThioMC6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0196 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-10 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0220 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C4 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | C4 showed strong specific binding to S. Typhimurium, and the increase in the fluorescence intensity of C4 was less than 30% against E. coli and S. aureus. | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0221 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGTCGGAGCCAGGATGCGAGGTCTGTAGGTCTGCGGGCGG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0222 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGCGGGCGAGTTGACGGCGTAATCGTGCTGCCGCGTG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0223 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGGGCGTGGCTCAGAGTGGGGGTCGGTCAGTCTTGTGCGCG-GGTGGATCCATATTCCTACTCG | 102 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0224 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C5 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGACGCCTGCGTGGCTGAGGCTTCGGTCTGCGCCG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0225 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGCGGGCAGGATGGGATGCTGTAGGTCTGCGGGCGCGCG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0226 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGCG-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0227 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C8 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGACGGGTACCGGGCGTGTGGCGTGCCTGCCGCG-GGTGGATCCATATTCCTACTCG | 99 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0228 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | C9 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGTGCGGGCCGGATGGGAGCTCTGTAGGTTGCGGGCGCGG-GGTGGATCCATATTCCTACTCG | 101 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0229 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA1/SA-1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGA-GGTGGATCCATATTCCTACTCG | 82 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0230 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA2/SA-2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 83 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0231 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA3/SA-3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGAGGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0232 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt22 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 80 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | LOD of the method was 10(3) cfu/mL with a range from 10(3) to 10(7) cfu/mL, and detection signals of target bacteria were 4.4-fold higher than S. Enteritidis, 4.3-fold higher than S. Arizonae, 56.3-fold higher than S. aureus, and 24.3-fold higher than E. coli K88. | 17 | Fluorescence Spectroscopy | 47 ± 3 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0233 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt10 | GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 83 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 73 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0234 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 45 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC-GATGGACGAATATCGTCTCCC | 79 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 68 ± 6 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0235 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 60 | GAATTCAGTCGGACAGCG-CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG-GATGGACGAATATCGTCTCCC | 76 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 56 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0236 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA17 | TCCCTACGGCGCTAAC-CCCCCCAGTCCGTCCTCCCAGCCTCACACC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 312 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 35 nM and 3.03 nM for SA17-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0237 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA61 | TCCCTACGGCGCTAAC-CTCCCAACCGCTCCACCCTGCCTCCGCCTC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 1250 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 129 nM and 9.9 nM for SA61-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0242 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 1 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTCTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0243 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 2 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTGTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0244 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 3 | GCAATGGTACGGTACTTCC-CGCCGCCGCGTTCTCATCGCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 17.5 ~ 20 nM (for ALS) and 30 ~ 35 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0245 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 4 | GCAATGGTACGGTACTTCC-CGCCGGCTTCTCTTGCCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 75 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 nM (for ALS) and 20 ~ 25 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0246 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 5 | GCAATGGTACGGTACTTCC-CGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | ALSap-5 at 0.5 µM, about 90% of biofilm, 50.9% reduced pyocyanin secretions, as well as secretions of LasA protease and LasB elastase were inhibited. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 ~ 12.5 nM (for ALS) and 20 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0247 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 6 | GCAATGGTACGGTACTTCC-CGGGGCGGGCTGTCATGCCCATCCTACCGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 ~ 17.5 nM (for ALS) and 45 ~ 50 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0248 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 7 | GCAATGGTACGGTACTTCC-CGGGGCGGCCTGTGTTGGCCTACCTAGCGAGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 12.5 ~ 15 nM (for ALS) and 35 ~ 40 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0249 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 8 | GCAATGGTACGGTACTTCC-CGCTGCCCCCTGTCCTGGGTTAGCTAGCGAGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | 86% of pyocyanin secretion was inhibited by 6 µM of ALSap-8, and biofilm formation, and the secretions of LasA protease and LasB elastase were also decreased by 9.3%, 17.5%, and 19% respectively. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 nM (for ALS) and 25 ~ 30 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0255 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A15 | GGGAGCTCAGAATAAACGCTCAA-TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | Display a LOD of 75 CFU/mL and a wide linear range from 10(2) to 10(7). | 8 | Fluorescence Spectroscopy | 48.74 ± 3.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0256 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A1 | GGGAGCTCAGAATAAACGCTCAA-GGGGGGCCTAGACTAGGGGGAGAGGGTGGGACGGT-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 86.41 ± 3.34 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0257 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A10 | GGGAGCTCAGAATAAACGCTCAA-GGGGCGGCGGCGGTGGTACGGGGTTGGGAGCGGGC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 203.12 ± 1.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0258 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A9 | GGGAGCTCAGAATAAACGCTCAA-GGCGTATGCGCAGCGAGGGCGGCCGGGCGACGTCG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 88.36 ± 3.60 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0259 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A8 | GGGAGCTCAGAATAAACGCTCAA-CCACGGGAACAACATCGTGGCAGGGACGAGCGTCCT-TTCGACATGAGGCCCGGATC | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 120.91 ± 2.85 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0260 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A4 | GGGAGCTCAGAATAAACGCTCAA-GCGCGCTGCCGACGCGGGGGGGCTGATTAGCGTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 205.83 ± 1.65 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0261 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A13 | GGGAGCTCAGAATAAACGCTCAA-ACTGAGGGGCGGCGGACGGGATGGGAAATGTAGG-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 299.94 ± 1.67 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0262 | https:doi.org10.1016j.foodcont.2013.03.011 | 2013 | Selection, identification and application of a DNA aptamer against Listeria monocytogenes | A12 | GGGAGCTCAGAATAAACGCTCAA-TAGCGTGGGTAACCGTGTTGGGGGGTGCCACGGTC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to recognise Listeria monocytogenes. | N/A | 8 | Fluorescence Spectroscopy | 63.41 ± 3.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0263 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A1 | AGCAGCACAGAGGTCAGATG-AGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 92.17 ± 16.75 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0264 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A15/40 | AGCAGCACAGAGGTCAGATG-TACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | Limit of detection of 8.7±10(-3) μg/mL with linear range of 0.01-10 μg/mL SEA. | 12 | Fluorescence Spectroscopy | 48.57 ± 6.52 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0265 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.2 | AGCAGCACAGAGGTCAGATG-ATGATCGTAGTCATTTAAAATTTGAATACTATCAAAGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | 235.00 ± 79.05 nM | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0266 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A3 | AGCAGCACAGAGGTCAGATG-TACGAGCGGTGGTTTTACCCTGCAATACTTTTGGCTGTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0267 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A25 | AGCAGCACAGAGGTCAGATG-ATAGATTTTTTTCATGATTCTTCATTTTTTTATTTGAAAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0268 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A29 | AGCAGCACAGAGGTCAGATG-TATTATCTTACTACGTTGCATCCTACTTTTATAGTCCCCT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0269 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A30 | AGCAGCACAGAGGTCAGATG-GGATCTTCCCTCAATGTTTATTGTATATCTGTACTCGTAA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0270 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A10 | AGCAGCACAGAGGTCAGATG-TCCAATTCAATTCATTTCTGAACTTAGTCGGCACTTTGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0271 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A4 | AGCAGCACAGAGGTCAGATG-CTCCAGCAGCCTCATAGATACGTCGTATCTATTGTTTCCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0272 | https:doi.org10.1039C3AY41576G | 2013 | Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A | A23.1 | AGCAGCACAGAGGTCAGATG-AAGGTCTTACATCAATTTATATATTTTTCCAATATCTGTC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and develop a fluorescent bioassay to detect SEA in the food sample. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | FluMag (NanoMag)-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0317 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E1 | GCAATGGTACGGTACTTCC-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 12.4 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0318 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E2 | GCAATGGTACGGTACTTCC-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 25.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0319 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E10 | GCAATGGTACGGTACTTCC-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-CAAAAGTGCACGCTACTTTGCTAA | 90 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 14.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0320 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E12 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 16.8 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0343 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | ZXL1 bound to virulent M. tb H37Rv much more strongly (52.2%) than to the other Mycobacteria strains tested, M. smegmatis (2.5%) and BCG (13.9%). LPS-stimulated human DC groups showed that ZXL1 decreased IL-10 production by 31–36% and increased IL-12 production by 52–91%, thereby reducing the progression of infection and bacterial loads in mice and rhesus monkeys. | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 436.3 ± 37.84 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated or FAM Labeled | ZXL1 showed no significant cytotoxicity at concentrations ranging from 2 to 15 microM at the 168-hour test. | N/A | Best Candidate | N/A | N/A |
| ABdb_0344 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-AGTCCACGATAATCACACACACGGACACCC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0345 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CACGCCCAATAGTGGCTCCAGCTCATCTCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0346 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL5 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CATCGATGTACCCTACCTACATGTTACGTT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0347 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL6 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-ACCTACAGCGACACCTAACTGAGTAGAACT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0348 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL7 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TACCTAACACTTCCTGCTCCACCTTTATTA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0349 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL8 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCTGATTCCCCCTCATCCGATGGACATCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0350 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL9 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GACCCTCATGATACCAACCACTCCAGTCAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0351 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL10 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TATCCCAGTGGCATTAACTACCCACTCGCA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0352 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL3 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCACGGAGTGAGGGGCTGTTCATTAAGAGA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0353 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL12 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGCCTGATAGGTCTGTGATCCAATCCAAT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0354 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL13 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCTGCTTGCCGCTGATCCGCCAATTCGATC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0355 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL14 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGTGCCGACGCTGCCGAATAGCACTGCAC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0356 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control. | 5 | Saturation Binding Assay | 0.415 + 0.047 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0357 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control. | 5 | Saturation Binding Assay | 1.261 + 0.280 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0358 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-27 | ACGGCTCGCACTCTCTGATTT-GGCATAGCTGCCGGGAGGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | The binding signal of EcA5-27 for E. coli NSM59 was notably higher (~ 1.5-fold) than for laboratory strains of E. coli, and 8.5- and 56-fold to additional uropathogenic isolates compared with laboratory strains. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 110 nM | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0359 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-01 | ACGGCTCGCACTCTCTGATTT-CGGCACCCCGTCGCTATGTTGACC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0360 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-02 | ACGGCTCGCACTCTCTGATTT-GGGGAGGTGGCGACCGCTTCTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0361 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-03 | ACGGCTCGCACTCTCTGATTT-GGGGTCAGATATTAAACCGTGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0362 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-04 | ACGGCTCGCACTCTCTGATTT-GGGAGAGGGAGTGGTCTGGGAGAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0363 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-05 | ACGGCTCGCACTCTCTGATTT-GCGGGCTTCGACACAGTGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0364 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-06 | ACGGCTCGCACTCTCTGATTT-GGGAGGGGCGGCGAAGGAGTGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0365 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-07 | ACGGCTCGCACTCTCTGATTT-GGAAGCGGTGGGGATCGTGTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0366 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-08 | ACGGCTCGCACTCTCTGATTT-GGGAGCAAATCCGGAATGTGGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0367 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-09 | ACGGCTCGCACTCTCTGATTT-GGCGGAGGGGTTCGGGGTTGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0368 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-10 | ACGGCTCGCACTCTCTGATTT-GGCGGGGCGTGGGGGATGTGTGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0369 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-11 | ACGGCTCGCACTCTCTGATTT-GGAATGCGAAGTGTGGCCTAGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0370 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-12 | ACGGCTCGCACTCTCTGATTT-GGGCGGGGGGGGATTCCGAGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0371 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-13 | ACGGCTCGCACTCTCTGATTT-GGGGGGGTGGCATTTTGGGGTGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0372 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-14 | ACGGCTCGCACTCTCTGATTT-GCGGGGAAAGAGAAGGAAGCGTCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0373 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-15 | ACGGCTCGCACTCTCTGATTT-GGGCCCGAGTGGCGGTAGTTTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0374 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-16 | ACGGCTCGCACTCTCTGATTT-GGGGGGTGGTGAAGGCCTGGGGGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0375 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-17 | ACGGCTCGCACTCTCTGATTT-GGGCCGGAGGGGCGCCTGCACCCA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0376 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-18 | ACGGCTCGCACTCTCTGATTT-GGGGTTAGGCGAGGGGGGTGGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0377 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-19 | ACGGCTCGCACTCTCTGATTT-CGGACGGTAGGGAAGGGGGGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0378 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-20 | ACGGCTCGCACTCTCTGATTT-GGCGAGGCAGGGTGCGGGGGCCCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0379 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-21 | ACGGCTCGCACTCTCTGATTT-GCGTGTGGTGGGTGAGGGGTCTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0380 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-22 | ACGGCTCGCACTCTCTGATTT-GGGGATAGCAGGACAATGAGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0381 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-23 | ACGGCTCGCACTCTCTGATTT-GGCCGCGTGTGTGTCCGACTGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0382 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-24 | ACGGCTCGCACTCTCTGATTT-GGGCGAGGAGAGAGGCGGAGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0383 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-25 | ACGGCTCGCACTCTCTGATTT-GCCGTGGTGTGTGTGATGGTCGGT-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0384 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-26 | ACGGCTCGCACTCTCTGATTT-GGCTTGGCTCCTCACGGGGGGTGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0385 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-28 | ACGGCTCGCACTCTCTGATTT-GGAGGGGTTGACCATGACCGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0386 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-29 | ACGGCTCGCACTCTCTGATTT-GGGGGAAGGGCCAATGGATTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0387 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-14 | GCTGCAATACTCATGGACAG-GTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | With a PI cutoff value of 40%, the ic-ELAA had higher positive detection rates than two commercial indirect ELISA. | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.61 ± 2.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0388 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-3 | GCTGCAATACTCATGGACAG-GCCGCGACCATACAACGCAAACAACACGCCTGTACGCTTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 32.81 ± 7.75 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0389 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-51 | GCTGCAATACTCATGGACAG-GTGCGAAGCGCCTCCACTGTACATCCACTCCTTCTGCC-GTCTGGAGTACGACCCTGAA | 78 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.81 ± 4.48 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0390 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-49 | GCTGCAATACTCATGGACAG-GCAGACGTCAGAACAATACCAATACTAATCCTTGGACCGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0391 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-20 | GCTGCAATACTCATGGACAG-CAACGAACAATACATTATCTACATCACATTGCCCCGCGTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0392 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-48 | GCTGCAATACTCATGGACAG-GCACGACATAACAACACTTATAGACTACTTCCCCCCTCGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0393 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-37 | GCTGCAATACTCATGGACAG-GTCCAAACACTATCTCTTCACTTGCTGTTGTTCCCGTGGC-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0394 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-82 | GCTGCAATACTCATGGACAG-GCACAACACATTAGACTTTGCTCTTCGGTCCCTCCGGCT-GTCTGGAGTACGACCCTGAA | 79 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0395 | 24417693 | 2014 | Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum | WKB-53 | GCTGCAATACTCATGGACAG-GCTACCACCAAACATACGCACTCGTCGTCTGCCCTATGTG-GTCTGGAGTACGACCCTGAA | 80 | 5'-GCTGCAATACTCATGGACAG-N40-GTCTGGAGTACGACCCTGAA-3' | ssDNA | Mycoplasma Bovis (M. Bovis) | P48 protein | Indirect competitive enzyme-linked aptamer assay (ic-ELAA) for the serological detection of M. bovis. | N/A | 11 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0405 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G43 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-AAUAGGAACUUAGAACAACCCUCUCCCUCAUGUAGCGAACCCGAACCAGG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | The affinity of aptamer G43 to EsxG was about ten times higher than the affinity of aptamer G78 and also showed no significant binding to EsxA. | 5 | Surface Plasmon Resonance (SPR) | 8.04 ± 1.9 nM | Detection | SPR based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0406 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G78 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-GCGUUUAAACGUUGCACCGUCGUUGACGGGACCGCUUGAGACAUUCGCUC-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | G78 showed some binding to EsxA, though a significantly lower binding signal was observed (p < 0.01) when compared to that of EsxG. | 5 | Surface Plasmon Resonance (SPR) | 78.85 ± 9.4 nM | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0407 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G31 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-UAACGACUCACCAACACAUCGACUAAUUUCCCUAAAUGACUUAACUGAAU-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0408 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G70 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-ACUCGUGACACUUACGAACGACCUAUGGCGGGAGAAUCCUAGCCGCUACG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0409 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt B12 | TGGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 15 ± 4 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0410 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H11 | TGGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 66 ± 7 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0411 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt C09 | TGGGAGCTCAGAATAAACGCTCAA-TGGCCGTGTGGATAGAGGCGTGTTGTATGGGTGTG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 52 ± 8 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0412 | 24763818 | 2014 | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | Apt H12 | TGGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGCCGTGTGTATGCTTGG-TTCGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | DNA aptamer library for rapid detection of ETEC K88 combined with immuno-magnetic separation (IMS). | Exhibit detection limit of 1.1 × 10(3) CFU/ml in pure culture and 2.2 × 10(3) CFU/g in artificially contaminated faecal sample with aptamer library. | 13 | Fluorescence Binding Assay | 106 ± 12 nM | Diagnostic | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0417 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT17 | CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0418 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT12 | CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0419 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT11 | CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0420 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT9 | CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0421 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT8 | CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0422 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT7 | CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0423 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT6 | CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0424 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5 | CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0425 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5.1 | CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0426 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT4 | CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0435 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-2 | AGTATACGTATTACCTGCAGC-TGGGGGGTGGTTGGGGGTAGTATATCGGGTCAGTGGTGCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0436 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-103 | AGTATACGTATTACCTGCAGC-GGGAGGCGTGAAGTGTGATGGTGTGGGGGGTAGTGGCCGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0437 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-109 | AGTATACGTATTACCTGCAGC-CCGCTCAACAAGGTGCTACAAAGATCCTGTGTCCCTTGGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0438 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-116 | AGTATACGTATTACCTGCAGC-TACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | LM6-116 showed strong genus-specific binding affinity when screened against five different species within the Listeria genus. | 6 | Flow Cytometry | 74.4 ±52.69 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0439 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-118 | AGTATACGTATTACCTGCAGC-CTGGTATAGACGTTATTCGTCCGCTCTTGTATCCTTGTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0440 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-121 | AGTATACGTATTACCTGCAGC-TGTCGGTGGGGGGTGGCTTGAGTACGTGACGTGGTGTGGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0441 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-2 | AGTATACGTATTACCTGCAGC-CCATTGTTCTATCGCTAGCTCGCTCTGGCCAGCTCCTTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0442 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-6 | AGTATACGTATTACCTGCAGC-TCTGTGTTCCGTTTTCGATTCTTACTGTGTTTTCGGGTGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | 106.4 ±43.91 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0443 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-13 | AGTATACGTATTACCTGCAGC-TGGGGGGGGGGGGAGGGGTCGGTGAGCGTGGGAGGAGGAG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0444 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-74 | AGTATACGTATTACCTGCAGC-CCGACCTTCTATCCTTCCAGTTTTTTGTAAACTCTTCTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0446 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mA_Apt1 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mA_Apt1 (~40% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | Best Candidate | N/A | N/A |
| ABdb_0447 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mB_Apt23 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mB_Apt23 (~20% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0448 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mC_Apt41 | CACAGCGGGACAGUUUAGC-CAGGCUGUUCUGACGCAUAAGGAAUGCGCUGUUGCAGAG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | mC_Apt41 neutralized 0.007 pmole of Stx2 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0449 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mD_Apt46 | CACAGCGGGACAGUUUAGC-UUGGUCCUGCUUUGGAUAGUCGCGAAAGGGGUGCCACUG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0450 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pA_Apt1 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0451 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pB_Apt14 | CACAGCGGGACAGUUUAGC-ACCGAGCGGUUUUACGUCUCAAGUAGUAUCCCGUUUUGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0452 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pC_Apt22 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer pC_Apt22 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0453 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pD_Apt25 | CACAGCGGGACAGUUUAGC-UUGCCAUCCUGUACUAUGCUCUAUCGGGCGGUUUAGUGAUCCUUCGUCCAACUAUC-GGUAGGUGGGUGCGUCUAAA | 95 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0463 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se1 | CACACCGGAAGGGATGCCACCTAAACCCC | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP of Se1 was approximately 100-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 4.66 ± 0.35 μM (of single aptamer) and 57.86 ± 14.5 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0464 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | Se2 | CACAGATGACGTCTGGCACATAATTAACAC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAP for Se2 was approximately 80-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 3.83 ± 0.10 μM (of single aptamer) and 55.84 ± 24.7 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0465 | 25096391 | 2014 | Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidis | St1 | CCGATGTCCGTTAGGGCTCCTCCATAGAT | 29 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium. | The binding efficiency of the PDAPs of St1 was approximately 20-fold higher than that of the single aptamer. | 10 | Fluorescence Spectroscopy | 0.530 ± 0.01 μM (of single aptamer) and 25 ± 5.6 nM (of PDAP) | Detection | Whole Cell-SELEX | 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0468 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b03 | TGGGAGCTCAGAATAAACGCTCAA-TTTTCCTGTTGTTGTTGTTTTTGGGGTTTTTTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0469 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h03 | TGGGAGCTCAGAATAAACGCTCAA-ATTTGTTTTGTTGGTGTTGTTGGCAGGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5′-DIG (Digoxigenin) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0470 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h04 | TGGGAGCTCAGAATAAACGCTCAA-TTTTTTGTTTTAGTTTTGTTTTGGTTTGTAGTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0471 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c04 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTTTTTGTGGGTTTGTTTTTTTCTTCTTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0472 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCGTTGTCGTTTTGTGTTTTTTTGGTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0473 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a04 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTGGTTTTTTCGTTTTTTTTTGTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0474 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b02 | TGGGAGCTCAGAATAAACGCTCAA-TATGTTGTCTTTTGTTTTGTGTTTTTTGTTGGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0475 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f01 | TGGGAGCTCAGAATAAACGCTCAA-GTGGTATAGTTCTTTTTTTTTGTTTTTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 150.8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0476 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | b04 | TGGGAGCTCAGAATAAACGCTCAA-TGGTCTTGTCGTTTTATTGTTTTTTTTTTTCTGTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0477 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e01 | TGGGAGCTCAGAATAAACGCTCAA-CTTTGTTCTTCTTTGCTTTTTTTTTCTTTTTTTGTT-CGACATGAGGCCCGGATCA | 79 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | Digoxigenin-aptamer could bind to the target L. monocytogenes with much higher specificity, resulting in a clear fluorescent signal. | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 60.01 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0478 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h02 | TGGGAGCTCAGAATAAACGCTCAA-TGTTTGTCTGTTTTCGTTTGTCTATTTGGTTCAGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0479 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e05 | TGGGAGCTCAGAATAAACGCTCAA-GCTGTTTTTTTCGTGTTGGGTTTTTTGTTTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0480 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d02 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTTTTTTTTTTGGTGTTTTTTTTTTATTTT-CGACATGAGGCCCGGATCA | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0481 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c03 | TGGGAGCTCAGAATAAACGCTCAA-TTGTTTGTTTTTTTTTTGGCTGTTATTTTGTTTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0482 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d03 | TGGGAGCTCAGAATAAACGCTCAA-CTGTCTTTTGTTTTTGTTGTGTTTTTTTGTTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0483 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g02 | TGGGAGCTCAGAATAAACGCTCAA-TGTCACTAGGCTTTTGGGATTCTCTGTGCATTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0484 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g01 | TGGGAGCTCAGAATAAACGCTCAA-TGTTGGTCTGTGTTATATTTTTTGTATCTCGTTCTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0485 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g03 | TGGGAGCTCAGAATAAACGCTCAA-TTCCTGGTTTATGTTGGGTTTTTTTGTTTCCTGGTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0486 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f04 | TGGGAGCTCAGAATAAACGCTCAA-GCCTTCTGCCTGTGTACGTTAGTGTTTGTGTCTATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0487 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d04 | TGGGAGCTCAGAATAAACGCTCAA-GGCTTTTTCGTCTTGTTCCTTGTTATTTGTTGTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0488 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e03 | TGGGAGCTCAGAATAAACGCTCAA-GGTTGTGCTTTGTATTCTCTTTTCTGTTTGATTTTTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0489 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | h01 | TGGGAGCTCAGAATAAACGCTCAA-TGTCTTTCCGTCGATATGCTGCTGACGCTTGGGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0490 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a02 | TGGGAGCTCAGAATAAACGCTCAA-TCACTGTTTGTCTGTTTGCTGGGTTTTTTGTTTTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0491 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c02 | TGGGAGCTCAGAATAAACGCTCAA-CTCTCAATGTGTATCTTGTTGCCGTTGTTCTTGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0492 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | d05 | TGGGAGCTCAGAATAAACGCTCAA-TGTAGTTTTTGTTTTGCGTGGTTTTAGATGCTGGCTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0493 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e02 | TGGGAGCTCAGAATAAACGCTCAA-TGTACCGGTGGTATTGTTTATGGTTGGCTGTTCTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0494 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | c05 | TGGGAGCTCAGAATAAACGCTCAA-CAGCCGGGGTGCGGGGCAAGGAGAGCGCGGTCAATTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0495 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | f02 | TGGGAGCTCAGAATAAACGCTCAA-CGGGGTGGGACTTTTAGCGTATTTGTGCTGGCGTGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0496 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | e04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGCGAGTGGAAGAGGCAGGGAAGGGAAATGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0497 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGGGGGGTATTGGCAGAGGTGGTTAGGTGGCCCTT-CGACATGAGGCCCGGATCA | 81 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0498 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | a03 | TGGGAGCTCAGAATAAACGCTCAA-GGCGGGAGGAGACCGACCAGGCTCAGGGTGGGGCGTT-CGACATGAGGCCCGGATCA | 80 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0502 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | 13.8% survival ratio of living cells in biofilms with 1.1 μM aptamer and 5 μg/mL ampicillin sodium. | 14 | Fluorescence Spectroscopy | 41 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0503 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 50 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0504 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 54 ± 2 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0505 | 26025307 | 2015 | Efficient suppression of biofilm formation by a nucleic acid aptamer | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Salmonella Choleraesuis | Flagella | Identify an aptamer that binds to flagella and inhibits biofilm formation by restricting its rotational frequency and covering its binding sites that attach to the matrix surfaces. | N/A | 14 | Fluorescence Spectroscopy | 53 ± 5 nM | Therapeutics | SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0506 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 36 | CCGTCAGCCGAGGACCACAC-TTGGTTGCTGAATCCCCTCGTCTTGGCTTTCTTTGTCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | Mtb36 aptamer bound to M. tuberculosis H37Ra bacteria more than 4 times for M. bovis and 70 times for E. coli bacteria. | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5.09 ±1.43 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0507 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 17 | CCGTCAGCCGAGGACCACAC-GCGTCAATATGCTCGAGTCCCTTACTCCGTAATCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0508 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 57 | CCGTCAGCCGAGGACCACAC-GAGGCGGGGCGTACATGATGGAGGTGTTGTGTTCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0509 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 25 | CCGTCAGCCGAGGACCACAC-ATAGGAAGTATGCGGTCGTAGTTAATCGCCTGTCCTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0510 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 32 | CCGTCAGCCGAGGACCACAC-CTGGGCTCACTCACTGGCGTATCATTCGTCCGCGGTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0511 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 3 | CCGTCAGCCGAGGACCACAC-CGCTTCACGTGTCAGTGAATTTTCTCCATCGTTTGGTGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0512 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 40 | CCGTCAGCCGAGGACCACAC-TGTAGCGCATCTACGGGCTCTTCATTACGTCTATATCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0513 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 33 | CCGTCAGCCGAGGACCACAC-TTCACACACGGGTATAAACGCTCTGGTATGTCAAGCCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0514 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 35 | CCGTCAGCCGAGGACCACAC-TCGGACCTAGTGCTAGGGTCTCTAAGAAGTATCGGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0515 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 49 | CCGTCAGCCGAGGACCACAC-TTCTCCGATCTTAGTCAACTTGGACCATGAATGCGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0516 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 46 | CCGTCAGCCGAGGACCACAC-TATTTACGCTGACCGACGATTTTCTATCAGAGTGCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0517 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 13 | CCGTCAGCCGAGGACCACAC-CGATCACTGTACAGTCCTGGATAAGCCGTTCTTTCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0518 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 11 | CCGTCAGCCGAGGACCACAC-CGCCGGCCTTCTTACAAGACCTGTTCAATTCCCAGTGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0519 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 50 | CCGTCAGCCGAGGACCACAC-AGGCTCACGCCCTGTCAATACTGCCTCTTGTCCTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0520 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 38 | CCGTCAGCCGAGGACCACAC-ATTCGGCTGAAGACCCGAGCCGGTCATCCGGTGTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0521 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 28 | CCGTCAGCCGAGGACCACAC-CTCCATCACGTGTAGTCAGCTGACCATTGATCGTGCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0522 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 8 | CCGTCAGCCGAGGACCACAC-CTATCCCGTGGTCCATTGCTTTTCCCGGTCTCTTCTCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0523 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 52 | CCGTCAGCCGAGGACCACAC-CTTTGTGCCGGGAAAAGACTGGCCTGTGTTGACTTGCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0524 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 2 | CCGTCAGCCGAGGACCACAC-CGGCGCTTTTCTCATCCTACCTCCGCTCTTACCTGTATGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0525 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 9 | CCGTCAGCCGAGGACCACAC-GCCGTGCTGAGTCTGTCAGCAGTTTGCTAGTCTTCCCTGC-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0526 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 44 | CCGTCAGCCGAGGACCACAC-TTACACGAAGGCTCGGCCCATCTCTCTCGTGTCACTTCGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0527 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt1 | ATGCGGATCCCGCGC-CGAGTGAGGGCGAGGCGCGCTCCTGCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀ of 28.94 ± 0.002 nM and showed a MIC of 5.36 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.06 ± 0.10 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0528 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt6 | ATGCGGATCCCGCGC-CGGCCAGGGGACGAGCGCGCCCTGATCGTG-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀of 22.35 ± 0.001 nM and showed MIC of 6.24 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.210 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0529 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt1_M3 (17-mer) | ATGCGGATCCCGCGC-GAGGGCGAGGCGCGCTC-GCGCAAGCTTCGCGC | 47 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 5.36 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 4.90 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | N/A | N/A | N/A |
| ABdb_0530 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt6_M3 (20-mer) | ATGCGGATCCCGCGC-CAGGGGACGAGCGCGCCCTG-GCGCAAGCTTCGCGC | 50 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 6.24 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 364 nM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | Best Candidate | N/A | N/A |
| ABdb_0531 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt2 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.286 ± 0.64 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0532 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt3 | ATGCGGATCCCGCGC-GCCCACCTGTGGGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.677 ± 0.14 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0533 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt4 | ATGCGGATCCCGCGC-GCCCACGTGTGGTGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.956 ± 0.20 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0534 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt5 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.03 ± 0.12 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0535 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt7 | ATGCGGATCCCGCGC-ACGCGACAGCAGTGCGCGCCCCGTCCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.02 ± 0.13 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0536 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt8 | ATGCGGATCCCGCGC-CGACGGAGGGAGGCGCGCCACACTGGGTGC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.55 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0537 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt9 | ATGCGGATCCCGCGC-GCACCGGCAGGAGCGCGCCTCGCCCTCACT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.66 ± 0.22 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0538 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A11 | ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS. | 11 | Fluorescence Spectroscopy | 64 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC Labeled | Showed no cytotoxic effects on PBMCs. | N/A | N/A | N/A | N/A |
| ABdb_0539 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A2 | ATACCAGCTTATTCAATT-GATCGATCGATCAGTCAGTCGACCAACGCACGACACGCATCGCTCTATCTCGTCGAACAG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | A2 achieved 34% PBMC proliferation inhibition. | 11 | Fluorescence Spectroscopy | 26 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0541 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1 | C10 | AGCAGCACAGAGGTCAGATG-TATACTTCTAAAATTTGTTTGTATCTACGATGTTCTTCGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | Have a limit of detection of 6 ng/mL with a range of 0.01–10 μg/mL of SEC1. | 12 | Fluorescence Spectroscopy | 65.14 ± 11.64 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0542 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C2 | C36.2 | AGCAGCACAGAGGTCAGATG-TATCAGAATTAATGCTCTCGTAATTTTCGAATCGTCGTGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | 49.43 ± 11.76 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0543 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C3 | C34.1 | AGCAGCACAGAGGTCAGATG-CTTTCATTTTTATTCTTTTTGACTGTATTTTATGTACCAT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0544 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C4 | C4 | AGCAGCACAGAGGTCAGATG-CTAACCTAATTCGACCGTGTATTCTTCTGCGTTATTTACC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0545 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C5 | C10 | AGCAGCACAGAGGTCAGATG-TATACTTCTAAAATTTGTTTGTATCTACGATGTTCTTCGT-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0546 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C6 | C9 | AGCAGCACAGAGGTCAGATG-TCCATTATCAGGTTCTTTATTCTGTTGTTCAACTTATTAA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | 154.9 ± 45.67 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0547 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C7 | C32.1 | AGCAGCACAGAGGTCAGATG-TTTTAGATTTAGCTCTTATTTGTTCGAGCAATCCCAAAGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0548 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C8 | C2 | AGCAGCACAGAGGTCAGATG-GCCAACTCAATTTTTTGTTTTGTCTTTCCGATTGATCTTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0549 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C9 | C6 | AGCAGCACAGAGGTCAGATG-CATATCGAATTTTCCTCGTGATTTTTCTTTCATTCTTAGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0550 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C10 | C11 | AGCAGCACAGAGGTCAGATG-TAGTTAATGGATTTTTCTTCTTTATCTTCTTATTTCTTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0551 | 25053102 | 2015 | Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C11 | C30 | AGCAGCACAGAGGTCAGATG-ATGTTTTCCCTTATCACTACTTTTATTTGTCTTTTTGCAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin C1 (SEC1) | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect SEC1 in milk samples. | N/A | 12 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0559 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20 | CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 7 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0560 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20P | TTCACGGTAGCACGCATAGG-CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 61% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 12 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0561 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9 | GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 71 ± 23 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0562 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | D-Cells 9P showed an increase in the gated fluorescence above background by 65%. | 8 | Flow Cytometry | 44 ± 8 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0563 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 79 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | 20 ± 3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0564 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1 | GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG | 39 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0565 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 20P | TTCACGGTAGCACGCATAGG-GGGGAGGAGAAATAGAGGACCAGAGTAACGATTCGTGGGG-CATCTGACCTCTGTGCTGCT | 80 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0566 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-ACGGGCGTGGGAGGCAATGCCTTGCTTGTAGGCTTCCCCTGTGCGCG-GGTGGATCCATATTCCTACTCG | 107 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0567 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A14 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT-GGTGGATCCATATTCCTACTCG | 108 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | 3.49 ± 1.43 nM | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0568 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0569 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | A20 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCAGCGGGGGCTGCGCGGTGGAGTGCTGTGGGCG-GGTGGATCCATATTCCTACTCG | 98 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0570 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B3 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTG-GGTGGATCCATATTCCTACTCG | 104 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0571 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B6 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGTCGGTGTCTGCCGGGGGATGTGGAGGCTGGGTGTTGCGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | Showed specific binding to S. aureus. | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0572 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B7 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGGGCGGGCTACCTGGCTAGTACGCCATGATGCCTGCACGCG-GGTGGATCCATATTCCTACTCG | 105 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0573 | 25884791 | 2015 | Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers | B15 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-CACGCGCAAACAGATTAACACTCCGCCTAAGTCTGCCGCACGC-GGTGGATCCATATTCCTACTCG | 103 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Staphylococcus aureus (S. aureus) (KCCM 12103) | Whole cell | Identify aptamers against bacterial surface molecules and live Staphylococcus aureus. | N/A | 16 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0574 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/8 | ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | PA#2/8 competes with IgG or IgG-Fc for binding to Protein A. | 11 | Bead-based Binding Assay | 1.06 ±0.2 μM | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0575 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/22 | ATACCAGCTTATTCAATT-GCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0576 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/34 | ATACCAGCTTATTCAATT-CCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0577 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/11 | ATACCAGCTTATTCAATT-GGAGACGACAAACTATTACGTACTACGGCATGCACTTGGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0578 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/3 | ATACCAGCTTATTCAATT-CGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0579 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/6 | ATACCAGCTTATTCAATT-ACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCC-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0580 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#14/82 | ATACCAGCTTATTCAATT-CCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0581 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/52 | ATACCAGCTTATTCAATT-ACGCATTGGAGCCCGAAACTGATTCATTGAGCCTACCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0582 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#2/14 | ATACCAGCTTATTCAATT-ACGACCGTAGACGACTTACACTGATGTTGCGCATTTCTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0583 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#4/31 | ATACCAGCTTATTCAATT-CGATGACGACTGTAGCCGCAATACGCCCCTGTTACGTTGT-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0584 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/41 | ATACCAGCTTATTCAATT-GGACGCCGACTAACTTTACGTGGTTCTCCTACCGCCTAACC-ACAATCGTAATCAGTTAG | 77 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0585 | 26221730 | 2015 | In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A | PA#6/43 | ATACCAGCTTATTCAATT-ACGAAATGTAGCCGATCCTGATTACTCTCTGTCAGCTTGG-ACAATCGTAATCAGTTAG | 76 | 5'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3' | ssDNA | Staphylococcus aureus (S. aureus) (P3838) | Staphylococcus aureus Protein A (SpA) | Identify aptamers against Protein A. | N/A | 11 | Bead-based Binding Assay | N/A | Detection | FluMag-SELEX | 5'-Fluorescein Labeled and 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0586 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-1 | CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0587 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-2 | CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0588 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-3 | CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0589 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-4 | CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0590 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-5 | CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0591 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-6 | CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0592 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-7 | CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0593 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-8 | CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0594 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-1 | CGGATCCATGGGCACTATTTATATCAA-CCCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0595 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-2 | CGGATCCATGGGCACTATTTATATCAA-GGCTAGGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0596 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-3 | CGGATCCATGGGCACTATTTATATCAA-CCTTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0597 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-4 | CGGATCCATGGGCACTATTTATATCAA-GGCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0598 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-5 | CGGATCCATGGGCACTATTTATATCAA-CTGCACGTGGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0599 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-6 | CGGATCCATGGGCACTATTTATATCAA-GACTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0600 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-7 | CGGATCCATGGGCACTATTTATATCAA-GCCATTCGTCACTGAGTTGCTCTAGTGCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0601 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-8 | CGGATCCATGGGCACTATTTATATCAA-CTAAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0602 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-1 | CGGATCCATGGGCACTATTTATATCAA-GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0603 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-2 | CGGATCCATGGGCACTATTTATATCAA-GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0604 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-3 | CGGATCCATGGGCACTATTTATATCAA-TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0605 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-4 | CGGATCCATGGGCACTATTTATATCAA-TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0606 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-5 | CGGATCCATGGGCACTATTTATATCAA-CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0607 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-6 | CGGATCCATGGGCACTATTTATATCAA-CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0608 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-7 | CGGATCCATGGGCACTATTTATATCAA-GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0609 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-1 | CGGATCCATGGGCACTATTTATATCAA-CCTCACATAGTGACGATGTGGTTTGGTACCTCTATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0610 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-2 | CGGATCCATGGGCACTATTTATATCAA-CCGTGGATGTACGAAATTAACCGCACACCTAGCTACCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0611 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-3 | CGGATCCATGGGCACTATTTATATCAA-CGCATGCTTCTCGGGATACGGGCGGCTCGATAGAGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0612 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-4 | CGGATCCATGGGCACTATTTATATCAA-GCTTACTACGTTTGCCTCAGTGTGTTCCGGTCTTAACAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0613 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-5 | CGGATCCATGGGCACTATTTATATCAA-CCCATACCTTTTTCGATAGTAAGTGCCATGCCCATCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0614 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-6 | CGGATCCATGGGCACTATTTATATCAA-GCCTAGAACCCCCTGTCTAGTCAAGTAGTGCGAGTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0615 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-7 | CGGATCCATGGGCACTATTTATATCAA-GCCTTACCGCTCTATCACTCGTCTGTTGCCACTCAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0616 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-8 | CGGATCCATGGGCACTATTTATATCAA-TGCGCCGATAGTTTCGATCATGATGCATCTGGCTGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0617 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-9 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0618 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-1 | CGGATCCATGGGCACTATTTATATCAA-TTGCTACAGGTATTGCACAACCTCGTGTGGTGTCCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0619 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-2 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0620 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-3 | CGGATCCATGGGCACTATTTATATCAA-GCTGGCAACTGGATGCACTCGTCCTCAGCCTCGGTCAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0621 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-4 | CGGATCCATGGGCACTATTTATATCAA-GCCCGTGAGACTATACCCTATGCACTAGTTGCGTAATAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0622 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-5 | CGGATCCATGGGCACTATTTATATCAA-GCTCGCGTCTGAGGGAAGTTACGTTATTTCGCTTGTAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0623 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-6 | CGGATCCATGGGCACTATTTATATCAA-CCGGACTTTAAGCGGCTTCTCGTGGCTGGGTAATCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0624 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-7 | CGGATCCATGGGCACTATTTATATCAA-CCTGACCGATGTTGTATTAATGGCTCCGGGTCTTATGAG-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0625 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-8 | CGGATCCATGGGCACTATTTATATCAA-CGAGGGGTTGGTTTGTGGTGTTGCCGCCACTACAGCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0628 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA1 | UUCAGGGACCAGUGUUUGCCUUGUGCCAGUC | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 108 ± 33.4 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0629 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA2 | CCCAUAGUGAGUCGUAUUAAUUG | 23 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 296 ± 57.1 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0630 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA3 | GCGACCCUAUAGUGAGUCGUAUUAAUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 388 ± 79.2 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0631 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA4 | GCGCCCCUAUAUGAGUCGUAUUAAUUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 105 ± 10.9 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0632 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA5 | GCGCCCCCAUAGUGAGUCGUAUUAAUACGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | ABA 5 rescued cells to at least 50% maximum cell viability, with an IC50 value of 5 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 205 ± 69.8 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0633 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA1 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | 12.02 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0634 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA2 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0635 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E6-15 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0636 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-3 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0637 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-4 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0638 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E7-12 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAGTAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0639 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-5 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGTCTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0640 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E9-16 | GGGAGCTCAGAATAAACGCTCAA-CGGGCTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0641 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P6-5 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGCTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0642 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-4 | GGGAGCTCAGAATAAACGCTCAA-TACCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0643 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-8 | GGGAGCTCAGAATAAACGCTCAA-CATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0644 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCCTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | Display a sensitive detection of 200 nM alpha toxin. | 12 | Surface Plasmon Resonance (SPR) | 93.7 ± 7.0 nM | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) or 5'-FAM Labeled | N/A | N/A | N/A | Average half-life of ssDNA MREs in serum is about one hour. | N/A |
| ABdb_0645 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.26 | TGTACCGTCTGAGCGATTCGTAC-CCTTGCCGATGCCTTTACGGTCTAGTTTGGATGT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0646 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.01 | TGTACCGTCTGAGCGATTCGTAC-TCGGGCGATGATACTTAGCACGGTCTAGGTCAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0647 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.20 | TGTACCGTCTGAGCGATTCGTAC-TAGCGGCAGAGTAGCACTCTATAGGTCGATGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0648 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.02 | TGTACCGTCTGAGCGATTCGTAC-CGTGTCCTATTTTCTTCTCTGTTAACTCTCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 79 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0649 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.06 | TGTACCGTCTGAGCGATTCGTAC-GATTACTATAATTTCTTATCGTCCGACCGCCGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0650 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.39 | TGTACCGTCTGAGCGATTCGTAC-TTTGATCTCGTGTGTCTAGTTGCGGCGGATTGTC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0651 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.10 | TGTACCGTCTGAGCGATTCGTAC-GGTCAACCTCACCGACTGCCGACCGTTTAATTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0652 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.43 | TGTACCGTCTGAGCGATTCGTAC-CGTCATTGCCTCGTAGTATTCTTATAGTCGGTAG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0653 | 25633102 | 2015 | In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum | R12.44 | TGTACCGTCTGAGCGATTCGTAC-TCCCGAAAGCGCGTCAGCCTGGGAGGTTATGCGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Molecular recognition element (MRE) targeting alpha toxin | Identify aptamer against MRE and develop modified sandwich ELISA to detect alpha toxin in undiluted human serum samples. | N/A | 12 | Surface Plasmon Resonance (SPR) | N/A | Detection | SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0654 | 25590973 | 2015 | Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes | LMCA2 | ATACCAGCTTATTCAATT-CCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | Developed an aptamer-based sandwich assay (ABSA) platform to distinguish L. monocytogenes from other Listeria species and other bacterial genera. | Exhibited a linear response from 20 to 2×106 CFU per mL with a LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | 2.01×10(-12) M | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0655 | 25590973 | 2015 | Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes | LMCA26 | ATACCAGCTTATTCAATT-CGATGGGGATTACTTATCATGAGAAACCAGCAGCATTTG-AGATTGCACTTACTATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | Developed an aptamer-based sandwich assay (ABSA) platform to distinguish L. monocytogenes from other Listeria species and other bacterial genera. | Exhibited a linear response from 20 to 2×106 CFU per mL with a LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | 1.56×10(-10) M | Biosensor | Whole Cell-SELEX | Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0656 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.33 | TGTACCGTCTGAGCGATTCGTAC-CATAGGGTGCTTTTCAAGGCCACACGTTAGTGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | 100 nM or 6.6 μg/mL of Exotoxin A in human serum was detected. | 14 | Surface Plasmon Resonance (SPR) | 4.2 and 4.5 μM | Diagnostic | Decoy-SELEX | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0657 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.02 | TGTACCGTCTGAGCGATTCGTAC-TACGCCACACGTGGTGAGGGATTCGATCGCTTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0658 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.20 | TGTACCGTCTGAGCGATTCGTAC-TGCTATTCATCACCACTCTAGAGCCACTTTTAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0659 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.22 | TGTACCGTCTGAGCGATTCGTAC-TGGGCGGCGAGCCACCCGGCAATTTAGTACAGGC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0660 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.36 | TGTACCGTCTGAGCGATTCGTAC-AAAGCATCCAGCCGGTATGTGCCAGAGTCTCTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0661 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.38 | TGTACCGTCTGAGCGATTCGTAC-AAATGTGAGTGGCCAGGCATCAGGTACGTCGGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0662 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.03 | TGTACCGTCTGAGCGATTCGTAC-GGATAGGTGCCTCTGCTTCATCATGTTGAACTTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0663 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.13 | TGTACCGTCTGAGCGATTCGTAC-AGTTTCACCAGTCGCCTGTTAGCCGTGATATACG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0664 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.27 | TGTACCGTCTGAGCGATTCGTAC-TGTCAATATTACGTTGCTCTTAGGTTCACCATCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0665 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.28 | TGTACCGTCTGAGCGATTCGTAC-TTGTGATTCAAATAGGCGTGTTGGTGTGAGACCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0666 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.23 | TGTACCGTCTGAGCGATTCGTAC-CGTGGATCATGCTTCGCGTCGGTTTATAGGTTCC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0667 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.39 | TGTACCGTCTGAGCGATTCGTAC-AGAAGAGCATCGGTAACTTCCATAGGAGATGGGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0668 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.06 | TGTACCGTCTGAGCGATTCGTAC-CATCCGAGGGTATTGTATGCGTATATCCTAGTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0669 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.10 | TGTACCGTCTGAGCGATTCGTAC-CAAGTTCCTCATGGAGGGTGCTCAGAGCTTAGAC-AGCCAGTCAGTGTTAAGGAGTAA | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0670 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.34 | TGTACCGTCTGAGCGATTCGTAC-AGGGGGATTCCTAGGGCCCGGCCCAACGCTGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0671 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.42 | TGTACCGTCTGAGCGATTCGTAC-CAAGACCCTTGAATCACGGGTAGGGTCTCGTAAC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0713 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp1 | TGAGCCCAAGCCCTGGTATG-TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 5.98 ± 0.835 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0714 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp13 | TGAGCCCAAGCCCTGGTATG-TATCCGATTTTATCTGTCCAATATTCCCTGTGTCTACCTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 97.38 ± 36.2 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0715 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp16 | TGAGCCCAAGCCCTGGTATG-TATCTTCACTTGACCTTTACCGCAATCGTCCATGTATCTG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 682.2 ± 125 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0716 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp19 | TGAGCCCAAGCCCTGGTATG-TTCTACCCAACTGCTTTAATAGTCACTGTCATAGTTCCAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0717 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp20 | TGAGCCCAAGCCCTGGTATG-TCGTCGATTATTGTTTCAGTTCAGTTCCCCCGCGTTCCGA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | With sandwich Sp1 and Sp20, the aptamer assay achieved a concentration range for S. sonnei of 10(2) cfu/mL to 10(7) cfu/mL and a detection limit of 30 cfu/mL. | 12 | Flow Cytometry | 14.32 ± 2.19 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and HEX (hexachlorofluorescein) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0718 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp22 | TGAGCCCAAGCCCTGGTATG-CCTACCTTAGTCCGTTTCGCTGTGTTTGTCCAATATTCCT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 4.98 ± 0.357 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0719 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp23 | TGAGCCCAAGCCCTGGTATG-CTTCACTTGACCCTTATCGCTTCTAACACAACCGCTTTTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 5.735 ± 0.478 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0720 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp28 | TGAGCCCAAGCCCTGGTATG-TATTCCCCCTTATTTTAGCCATTTTGTTACATCTTCCGTC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 72.89 ± 22.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0721 | https://doi.org/10.1039/C5AY00214A | 2015 | Selection, identification, and application of dual DNA aptamers against Shigella sonnei | Sp29 | TGAGCCCAAGCCCTGGTATG-ATATTCGTTCTTTTCGCCTTAACTTCTCGTGTTTCCTTAC-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Identify aptamers and develop a sensitive sandwich detection method using the dual aptamers Sp1 and Sp20 to detect S. sonnei. | N/A | 12 | Flow Cytometry | 47.83 ± 9.7 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0731 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL26 | TAGCTCACTCATTAGGCA-CATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | SAL 26 can detect 10(2) CFU/mL in the gold nanoparticle-based colourimetric assay and has a limit of detection (LOD) of 10(3) CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 123 ± 23 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0732 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL33 | TAGCTCACTCATTAGGCA-CTCGTATTGAGGAGCTCGTATTATTTAATTCACACTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 221 ± 72 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0733 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL28 | TAGCTCACTCATTAGGCA-CTCTGTCGTCAACAGTCTAACTTGTAGAATTGATGTTACTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 195 ± 46 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0734 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL43 | TAGCTCACTCATTAGGCA-CGAGACCACCGGCAACCTTTCACAAAGGGGAGGCTAA-GCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 112 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0735 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL21 | TAGCTCACTCATTAGGCA-CAGCAACTCGCTTTGATACCGGTAGAGTTTGTATTGCTCAA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0736 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL37 | TAGCTCACTCATTAGGCA-CTTAGTTCAGACGCGAGTATTATCGGCGTCCAAGCAAGGG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0737 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL20 | TAGCTCACTCATTAGGCA-CATATTCAGCAGTTGTATGATAGCGGGTCGCGAGTGTGTAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0738 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL40 | TAGCTCACTCATTAGGCA-CTGCATTACATATATGGCAGTGGGTTAACCTGGATTGAGGA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 204 ± 73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0739 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL16 | TAGCTCACTCATTAGGCA-CCCGATTGTACTAATGAAGATGGACACTGAGAGGGGGATGG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0740 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL11 | TAGCTCACTCATTAGGCA-CTCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 184 ± 43 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0741 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL45 | TAGCTCACTCATTAGGCA-CCGTGCCAACTGAGGGATACAGGGGGAGTGTCGGTCTACCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 133 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0742 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL23 | TAGCTCACTCATTAGGCA-CCTCACAGCCCTTCTTCCCGTATTTGTAGACTAGTTACATT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0743 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL48 | TAGCTCACTCATTAGGCA-CCACACTGTCTTGATTTTGGATTTGTCGGTGCTGACCTGTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0744 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL9 | TAGCTCACTCATTAGGCA-CTGCGAGTGAACTCCTCCTTTTGTATTTAGTGTGCGGATCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0745 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL29 | TAGCTCACTCATTAGGCA-CATGTGGAGTGCGAACTGTCTGGTCTTATCGGGCTCGCTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0746 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B5 | CAGTCCAGGACAGATTCGCGAG-CCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | LOD was 7.9 × 10(3) CFU/mL and a linear range from 7.9 × 10(2) to 7.9 × 10(6) CFU/mL of S. typhimurium with less than 1 h. | 10 | Quartz Crystal Microbalance (QCM) | 58.5 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0747 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A24 | CAGTCCAGGACAGATTCGCGAG-GCACAATCCACCTCTCACCGCACGCCACGCACTGCCTCTGTCCCG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 19.63 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0748 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B30 | AATCGCTGAATGAAATCCACGTG-GGAAGTGTGTGGGTGACCAGAGGTGTGGTGATGGGATTGTCGTA-CCTCGCGAATCTGTCCTGGACTG | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 51.02 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0749 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B31 | CAGTCCAGGACAGATTCGCGAG-CCGCACCGCCCTATCCTCGTGTCCCTGCCCAACAGCGCCGCCCGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0750 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A37 | CAGTCCAGGACAGATTCGCGAG-GTGGGGCGGGAAAGTGTGTGTAGGTGGTGGCGTTGTCACGGCGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0751 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B16 | CAGTCCAGGACAGATTCGCGAG-GGGCTGTGTGAGAAGTGGGTGTGGTGGTGGATATGCAACGTTGTA-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0752 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B21 | CAGTCCAGGACAGATTCGCGAG-GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0753 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCCATGAACTAGGCTCCACAATGAGTTTGG-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | Ki of BM2 was estimated to be 10.34 ± 0.27 nM, with a LOD of 1 × 10^4 cfu/100 μL of BCG. | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 8.59 ± 1.23 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated | BM2 was demonstrated to be safe with low toxicity based on in vitro and in vivo toxicity analyses. | BM2–BCG complex could be detected and remained stable for at least 30 days in vivo. | N/A | N/A | N/A |
| ABdb_0754 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGGTCGTAGACCGGGAGTTGTTGTTAGTTCA-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0755 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGCGCAGCGGGTCGACTTCATTCCTCACCAT-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0761 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-52 | CATACGATTTAGGTGACACTATAG-CCGCCCAGCGGGGGTAGGGCCGGACGTAGGAGGAGCTGCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-52 bound strongly to all three Gram-positive bacteria tested (S. aureus, E. faecalis and E. freudini). | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 11.97 ± 2.94 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0762 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-31 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 89 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-31 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 87.03 ± 17.32 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0763 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-55 | CATACGATTTAGGTGACACTATAG-CCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-55 to E. coli cells was more than 100-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 161.0 ± 34.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0764 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-17 | CATACGATTTAGGTGACACTATAG-GACGGTGGCAGGGAAAGGGGTCGGGCATATGGCGGAGGGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-17 could only bind to E. faecalis. The binding of P12-17 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 56.33 ± 15.87 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0765 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-11 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 85 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0766 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-21 | CATACGATTTAGGTGACACTATAG-CCGGAGGTGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0767 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-9 | CATACGATTTAGGTGACACTATAG-TGCGGGCGGAGGACACGGACCCGTATGGGAGCAATGCACG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0768 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-15 | CATACGATTTAGGTGACACTATAG-GGCCACCCACAGGCACTCCGCTCATGAATCGTGGAGTCGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0769 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-30 | CATACGATTTAGGTGACACTATAG-CACCACGGACACGATCCCAAGCTAGGAGGTGCGGCGGGGT-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0770 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-48 | CATACGATTTAGGTGACACTATAG-TGGCACAGCACGTCGCACGGTCCCCGGGAGGTGTTCACTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0771 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-51 | CATACGATTTAGGTGACACTATAG-TCGCGAGTGCGTGTACGCCACACATCACAAAAGGGGTGTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0772 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-66 | CATACGATTTAGGTGACACTATAG-GGCAACATTCAGACATACCAGTACCCACTCGGACTTCCCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0776 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 (31) -Truncated | UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG | 31 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 225 nM | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0777 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 | AUACCAGCUUAUUCAAUUGCACGAAUUUGCUGUGUUUUUGGGGGGGUCGGGGAGUAUAAGAUAGUAAGUGCAAUCU | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0778 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec2 | AUACCAGCUUAUUCAAUUCUUCUUUGAUCUGCUCGUAUCAUGGGACGGGAGGGUAUAGAUAGUAAGUGCAAUCU | 74 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0779 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec5 | AUACCAGCUUAUUCAAUUCGAAUUUAAGUUUCUUUUCUGGUAUAGUGGUUGGGUGGGUAAGAUAGUAAGUGCAAUCU | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0780 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L18A | GCCTGTTGTGAGCCTCCTAAC-TCCTCGAGGGGGGGGGGATGAAAAGGAAAACGCAACAA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | 74% efficiency toward the S. pyogenes serotype M3. | 12 | Flow Cytometry | 7.47 ± 1.72 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0781 | 28121169 | 2016 | Development of a DNA aptamer that binds specifically to group A Streptococcus serotype M3 | 12L12A | GCCTGTTGTGAGCCTCCTAAC-GAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATA-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Group A Streptococcus (GAS) serotype M3 | Whole cell | Identify aptamers against S. pyogenes serotype M3. | N/A | 12 | Flow Cytometry | 8.25 ± 1.43 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0796 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC2 | TGCAGGATCCGGTATCCGTGGACGGTGTGCAGGATCCGGTATCCGTGGGCACGAGAATTCCTCCGTTGCG | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | LOD in the minimum quantity of 5 ng SEB per 100 µl of human serum. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.3 × 10(−11) M | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0797 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC3 | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0798 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC7 | TGCAGGATCCGGTATCCGTGGGCGGGGCCATGCAGGATCCGGTATCCGTGGGCCGCAACGGAGGAATCTCGT | 72 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0799 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC8 | CCGTGGCCGCAACGGAGGAATTCTCGT | 27 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0800 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC9 | ACGAGAATTCCTCCGTTGCGGCACAGTTGGGCAGGAACCTGTGGGGCGTGCGCAACGGAGGAATTCTCGT | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0801 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC10 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACC | 33 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0802 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC11 | TGCAGGATCCGGTATCCGTGCGCAACGGAGGAATTCTCGT | 40 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0803 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC12 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACAGGATCCTGCATGCCTGTCCACGGATACCGGATCCTCA | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0804 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC17 | TGCAGGATCCGGTATCCGTGCCAAACACACCAAAAGCCCCCCCAACCCACAACCACGTCC | 60 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0814 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 63 | GCCTGTTGTGAGCCTCCTAAC-AGGAGGCGAACGGGCAGGTTCTTGGGGAGACAAGAATAAG-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | Clone 63 could detect Hib in patients’ CSF samples at 60 CFU/mL. | 7 | Flow Cytometry | 28.46 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0815 | 26768582 | 2016 | DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX | Clone 2, 42, 45 | GCCTGTTGTGAGCCTCCTAAC-GCCAGGTGTTTTGGCGGTAGGGGTGAAACAACAGGGGG-CATGCTTATTCTTGTCTCC | 78 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Haemophilus Influenzae type b (Hib) (ATCC 10211) | Whole cell | Identify an aptamer against Hib for the detection of H. influenzae. | N/A | 7 | Flow Cytometry | 47.10 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0823 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates. | 14 | Fluorescence Spectroscopy | 41 ± 2 nM | Therapeutics | Whole Cell-SELEX | 3'-Amidation (NH₂) and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0824 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 50 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0825 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 54 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0826 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 53 ± 5 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0827 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.971 ± 0.013 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0828 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-2 | AAGGGCTGGCTGGGATGGA-TGTAAGAAGGGAGGAAAGGACCTAAGACCTGCTATATTGCGA-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.309 ± 0.071 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0829 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-3 | AAGGGCTGGCTGGGATGGA-GGATGGCATTACCTATGCGGTAGATTGCCGACGACCACGAC-TCACTCCACGGACCCCACT | 79 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | N/A | 12 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0830 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt22 | GCTGTGTGACTCCTGCAA-GCGGGAAGAGGGTAAGGGGAGGGAGGGTAACGCGGAGAAGGCAA-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | Display LOD in PBS and serum of 1.5 nM and 2.1 nM, respectively, with an analytical linear range from 5 to 200 nM of FbpA. | 12 | Flow Cytometry | 62.95 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0831 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt8 | GCTGTGTGACTCCTGCAA-TCAGGAAAGAACTTAGGGGTGGGAGGAGGGTATAAATACGGAAT-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | N/A | 12 | Flow Cytometry | 202 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0843 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-6 | CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT | 117 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 107.6 ± 67.8 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0844 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-5 | CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT | 123 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | 57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity. | 10 | Flow Cytometry | 120.4 ± 32.2 pM | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0845 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-1 | CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0846 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-2 | CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0847 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-3 | CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0848 | 28818557 | 2017 | DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method | AM-4 | CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT | 118 | 5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains. | N/A | 10 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0849 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K3 | GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA | 63 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | Detected 10(2) CFU of CSF isolated N. meningitidis. | 6 | Flow Cytometry | 28.3 ± 8.9 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0850 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K4 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | N/A | 6 | Flow Cytometry | 39.1 ± 8.6 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0851 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-5 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | Display a LOD of 10(4) with a linear range from 10(4) to 10(7) cfu/mL. | 12 | Flow Cytometry | 10.69 ± 0.89 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0852 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-2 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0853 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-4 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0854 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-12 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0855 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-1 | AGCAGCACAGAGGTCAGATG-CGCCCTACACCACTCTCGGAGCGCTGTACGGCATCCCTGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0856 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-15 | AGCAGCACAGAGGTCAGATG-GCCCGCACCACACACAGATGTCCATGTGTGCGCTGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0857 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-11 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0858 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-23 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCCCCGATATAGCGACGCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0859 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-14 | AGCAGCACAGAGGTCAGATG-GCCTGGCCAGGTGCGCCGATATAGCCTGCCCTTGCCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0860 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-18 | AGCAGCACAGAGGTCAGATG-GCCTGGCCACGTGCGCGGATATAGCCTGCCCTTGGCCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0861 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-9 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0862 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-25 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0863 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-28 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCCCGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0864 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-7 | AGCAGCACAGAGGTCAGATG-GCCCCGGACGGCGGGAAGCCTCGTACCCCGGGTGAGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0865 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-6 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0866 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-17 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0867 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-21 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0868 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-26 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0869 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-27 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0870 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-30 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCCGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0871 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-29 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCCGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0872 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-3 | AGCAGCACAGAGGTCAGATG-TGCGTGAGCGGTAGCCGGGTACGACCCACTGTGGTTGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0873 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-13 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0874 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-16 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0875 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-22 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0876 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-24 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0877 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-19 | AGCAGCACAGAGGTCAGATG-GTCACACGGCCCGTCTGCGGTGTGGGACGCCCGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0878 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-20 | AGCAGCACAGAGGTCAGATG-GTCACACCGGCCGTCTCCGGTCTGGCACGCCGGCTGTGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0879 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-8 | AGCAGCACAGAGGTCAGATG-GCCCGCGCCCCTTCTGCCGTTGGTCGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0880 | 28441340 | 2017 | Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum | CCFM641-10 | AGCAGCACAGAGGTCAGATG-GCCCGCGCGGGTTCTGCCGTTGGTGGGAACCCCTGTGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Bifidum (ATCC 29521) | Membrane protein | Identify aptamers that bind to and develop a sandwich-type colorimetric bioassay for the detection of B. bifidum. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0881 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2p | AGCAGCACAGAGGTCAGATG-CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 8.9% for BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0882 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10p | AGCAGCACAGAGGTCAGATG-GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 11.2% for BB10p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0883 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16p | AGCAGCACAGAGGTCAGATG-CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | The per cent gated fluorescence intensity above the background was 7.0% for BB16p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0884 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2 | CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | BB2 showed a lower binding affinity than the aptamer BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0885 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10 | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0886 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16 | CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0887 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-6f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTT | 34 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0888 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-10f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCA | 30 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0889 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-14f | GGCCCCCTGCCTGCCAAAAAGGTGTT | 26 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0890 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-2r | CCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 38 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0891 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-9r | CCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 31 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0892 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-13r | CCAAAAAGGTGTTGCCAGGTTGGCGGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0893 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-11f | CTCCCAGGCCGTTGGGGCGTTGCCTGCGT | 29 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | LOD of the assay was 1000 cfu/mL with a linear range from 10(3) to 10(7) cfu/mL. | 12 | Flow Cytometry | 18.66 ± 1.41 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0894 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-13f | CTCCCAGGCCGTTGGGGCGTTGCCTGC | 27 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0895 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-15f | CTCCCAGGCCGTTGGGGCGTTGCCT | 25 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0896 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-8r | CCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 32 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0897 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-3 | ATACCAGCTTATTCAATTCCA-TGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 39.32 ± 5.02 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0898 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-4 | ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 15.89 ± 1.77 nM | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0899 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-1 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACCTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0900 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-2 | ATACCAGCTTATTCAATTCCA-CCCCATGTCTGTTTCTTTTAACAGGTAATCCGCCTTATGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0901 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-5 | ATACCAGCTTATTCAATTCCA-CAGGACAAAAATTCGGGAAGGCGGCCTTCCACTCTTTCTG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0902 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-6 | ATACCAGCTTATTCAATTCCA-ATACAGTGAAGGCCCAGGAGGCAAATTCTAGGACGAAAGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0903 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-7 | ATACCAGCTTATTCAATTCCA-CACCAAGTCGCCTCCTCTGCCCCCATGTAAATCGTTACAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0904 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-8 | ATACCAGCTTATTCAATTCCA-GAACAATTTCACGCACACCGCGTAGATACCACCTCGTGCA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0905 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-9 | ATACCAGCTTATTCAATTCCA-CGACGAACTACACCACAGGCCCTTAACACATCTACTTGTA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0906 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-10 | ATACCAGCTTATTCAATTCCA-CATGCTAACTGCCATCACCACTATTTATGATTCCATCCAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0907 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-11 | ATACCAGCTTATTCAATTCCA-CGCAACACAGAAACACCCGTACACAAACAGTTTCAGCCCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0908 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-12 | ATACCAGCTTATTCAATTCCA-TGCGTAGTTCTCTTAACAACCATTCAGCGTATTTTCGTGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0909 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-13 | ATACCAGCTTATTCAATTCCA-CAGGCACGAGTTCATCACACACCATACACAGTTCGTTACT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0910 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-14 | ATACCAGCTTATTCAATTCCA-CCACACCACACACTACACGCATAAAACCACGAAACTACAC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0911 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-15 | ATACCAGCTTATTCAATTCCA-GGGTATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0912 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-16 | ATACCAGCTTATTCAATTCCA-CATACAGTGGCCAGATTTACCAACACACCTTTCCATACGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0913 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-17 | ATACCAGCTTATTCAATTCCA-CCACTCACATATTAACAACACCACATGAATATATTTCG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0914 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-18 | ATACCAGCTTATTCAATTCCA-ACAGGGCATGTCTTCATCAACGCTTACCACACACCGCTCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0915 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-19 | ATACCAGCTTATTCAATTCCA-CACTCATGCGCACCGCGTCGCACTTAATCAGTGTTGTGC-AGATTGCACTTACTATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0916 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-20 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0917 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-21 | ATACCAGCTTATTCAATTCCA-CAGACACACCAACGCACGGGCACACGCTACAAATGTAAGT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0920 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | The detection time for M. tuberculosis was 70 min, and the detection limit was 100 cfu/mL. | 14 | Fluorescence Spectroscopy | 37 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0921 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 97 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0922 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 101 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0923 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 98 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0924 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 5 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTACCCGATATGTGTCCGAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 96 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0925 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 6 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 6 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0926 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 7 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGTGGTGTTGGTTGGTTGTGCGTGGAGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 107 ± 9 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0927 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 8 | GGGAGCTCAGAATAAACGCTCAA-GGCAGCAGCAATGTAACACTGTGTGTATGTGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 102 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0928 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 9 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 108 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0929 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer10 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAGGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 3 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0930 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer11 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0931 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer12 | GGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGTCGTGTGTGTGCTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0933 | 28454652 | 2017 | Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64 | Aptamer 17 | TCACTTCAAATGTGCGCTTC-GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC-CGTCAAAACAGGGGGTAGAA | 80 | 5'-TCACTTCAAATGTGCGCTTC-N40-CGTCAAAACAGGGGGTAGAA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 protein (Rv1980c) | Identify DNA aptamers against MPT64 protein. | The ELONA assay had a sensitivity and specificity of 91.3% and 90% on sputum samples. | 10 | Surface Plasmon Resonance (SPR) | 8.92 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0935 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.1A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAACAAA(U^y)G(U^y)GACCA(U^y)GCGA(U^y)(U^y)CCCCA(U^y)A(U^y)CCAGGCACA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0936 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.2A | GCGC(U^y)CGCGCGGCG(U^y)GC-GA(U^y)GCG(U^y)G(U^y)GG(U^y)G(U^y)GGAG(U^y)(U^y)G(U^y)G(U^y)GAG(U^y)GG(U^y)C(U^y)GCG(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0937 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.5B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)CA(U^y)GCCC(U^y)G(U^y)G(U^y)C(U^y)(U^y)GC(U^y)C(U^y)(U^y)G(U^y)GAG(U^y)(U^y)G(U^y)(U^y)G(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0938 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.8A | GCGC(U^y)CGCGCGGCG(U^y)GC-G(U^y)G(U^y)G(U^y)A(U^y)GCG(U^y)(U^y)CA(U^y)G(U^y)GG(U^y)GAGG(U^y)C(U^y)(U^y)GCG(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0939 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.10A | GCGC(U^y)CGCGCGGCG(U^y)GC-GAG(U^y)G(U^y)G(U^y)G(U^y)GGG(U^y)CCGAG(U^y)GGG(U^y)GG(U^y)CAGGG(U^y)(U^y)(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0940 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.14B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)G(U^y)G(U^y)GCGG(U^y)G(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)GGG(U^y)(U^y)G(U^y)(U^y)(U^y)G(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0941 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.16B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)(U^y)GCG(U^y)CCGGG(U^y)(U^y)(U^y)A(U^y)GCGGG(U^y)(U^y)G(U^y)C(U^y)CG(U^y)G(U^y)C(U^y)G(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0942 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.17B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)C(U^y)(U^y)G(U^y)(U^y)GGG(U^y)CGACGG(U^y)C(U^y)G(U^y)(U^y)CA(U^y)G(U^y)GGG(U^y)G(U^y)(U^y)G(U^y)CCC-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0943 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.18B | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)(U^y)G(U^y)G(U^y)(U^y)CACG(U^y)CA(U^y)(U^y)(U^y)CGCAC(U^y)CC(U^y)C(U^y)CAGC(U^y)ACG(U^y)(U^y)(U^y)(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0944 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.24A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)G(U^y)G(U^y)(U^y)(U^y)G(U^y)GG(U^y)ACGAGCG(U^y)G(U^y)G(U^y)GGA(U^y)GG(U^y)CCG(U^y)G(U^y)CA-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 76 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0945 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.28A | GCGC(U^y)CGCGCGGCG(U^y)GC-(U^y)CC(U^y)CGCG(U^y)(U^y)(U^y)GGA(U^y)(U^y)CA(U^y)G(U^y)(U^y)GG(U^y)(U^y)(U^y)G(U^y)CGG(U^y)G(U^y)A(U^y)(U^y)G(U^y)-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 77 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | Showed the highest % binding to the DH5α cells, with per cent bound ranging from 2.9 to 21%. | 12 | Saturation Binding Assay | 27.4 ± 18.7 nM | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) and Radiolabelled ([γ-32P]-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0946 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.30A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 81 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0947 | 28551117 | 2017 | Electrochemical determination of M. tuberculosis antigen based on Poly(3,4-ethylenedioxythiophene) and functionalized carbon nanotubes hybrid platform | MPT64 aptamer | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor based on MWCNT-doped PEDOT nano-composite for the detection of Mycobacterium tuberculosis. | Exhibits a LOD of 0.5 fg/mL within 15 min for the detection of M. tb antigenic protein with recovery in between (88–95)%. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The stability of the aptasensor is 27 days at 4°C, and the reusability is 7 times after repeated regeneration with 50 mM NaOH. | N/A | N/A | N/A |
| ABdb_0979 | https://doi.org/10.1007/s00604-017-2174-7 | 2017 | Aptamer based voltammetric biosensor for the detection of Mycobacterium tuberculosis antigen MPT64 | Aptamer 3 | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an aptaelectrode based on graphene modified iron-oxide chitosan hybrid (CHIT-IO-GR) nanocomposite film deposited on fluorine tin oxide (FTO) for the detection of the M. tb. specific antigen MPT64. | Exhibited a limit of detection (LOD) of 0.9 fg/mL within 20 min and a linear range from 1.0 × 10(5) fg/mL to 1.0 fg/mL. | 10 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The biosensor retained about 80% of its initial activity after 10 uses and good stability of 17 day. | Best Candidate | N/A | N/A |
| ABdb_0982 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-01 | CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0983 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-02 | CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0984 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-03 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0985 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-04 | ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 39 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0986 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-05 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC | 38 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0987 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-06 | GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0988 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-07 | GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0989 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-08 | GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0990 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-09 | GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0991 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-10 | AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0992 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-11 | AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0993 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-12 | GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-12 showed better affinity to E. coli and S. epidermidis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0994 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-13 | GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0995 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-14 | CGGGGTGGGACCAGTCTTGCGCGGGTGAC | 29 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0996 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-15 | GGACTGGAGTCTAGACCGGGTAGCTGTGGT | 30 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1003 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 | GTCTTGACTAGTTACGCC-GGGAACAATATGTTCAAGGGCTCTTTAAAGTTTTAGTTCGTTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | LOD was 32 ng for H63. | 8 | Isothermal Titration Calorimetry (ITC) | 3.71 x 10-7 ± 2.12 x 10-11 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1004 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | Exhibited 2.5-fold higher binding with respect to the parent H63, and H63 SL-2 M6 has an LOD of 16 ng. | 8 | Isothermal Titration Calorimetry (ITC) | 9 x 10-8 ± 2 x 10-14 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1005 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H33 | GTCTTGACTAGTTACGCC-ACACTAGAAGGTATTTACTATTCTGTGTTAACATGTACTAGCCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1006 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H66 | GTCTTGACTAGTTACGCC-AAGTTTTAATACAACTCACATTAGGGAAAGCTTGCATCCAGGCC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1007 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H70 | GTCTTGACTAGTTACGCC-CAGGACAGGTTAAAATTTTTCTGGATCCCTTTTCATTCTCCATGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1008 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H3 | GTCTTGACTAGTTACGCC-CATACACGGTTACACGTACTGGATAATGTTGATTATGCTTCTGC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1009 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H18 | GTCTTGACTAGTTACGCC-TAGAACCAAACCTTGTGTAGAAGGGCTTCTCCCGTGTGCTTTGA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1010 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H47 | GTCTTGACTAGTTACGCC-GGATGAACTGTTCCGCTGTGTATCACGCCAAAAGTCCTTATTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1011 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H48 | GTCTTGACTAGTTACGCC-CATGAAACCATCTGGTCCGCAATGGGCGCTTGGAATATTCGTCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1022 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (30mer) | CGAGGGAGACGCGAACCTTCTCGCCTTGGG | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | Effective inhibitor of LF with an IC₅₀ of 15 ± 1.5 µM and ~85% cell viability. | 8 | Fluorescence Spectroscopy | 11.0 ± 2.7 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | In RAW 264.7 cells, the cell viability remained unchanged from 0.08 to 10 µM of ML12, indicating that it appears to be non-toxic. | N/A | Best Candidate | N/A | N/A |
| ABdb_1023 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML6 | GGACCAGCCGCCGCGCCTTGACCGGGGGTA | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1024 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML7 | GGAGAGAGGGAGACGCGCAACCTCGACCCGT | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1025 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML12 (60mer) | GCGCGGATCCCGCGC-CGAGGGAGACGCGAACCTTCTCGCCTTGGG-CGCGCGAAGCTTGCG | 60 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | 17.5 ± 4.8 nM | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1026 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-3 | TGACGAGCCCAAGTTACCT-GCCCCCGAACCATACCACACGATGCCCCGTACCCCAGCCACC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | Show a detection limit of 15 cfu mL-1. Biofilm formation was reduced from 100% to 35.8% at a Lyd-3 concentration of 1 μM compared with the no-aptamer control. | 20 | Fluorescence Spectroscopy | 661.8 ± 111.3 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1027 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-1, biofilm formation decreased to 90.8%. | 20 | Fluorescence Spectroscopy | 844.7 ± 123.6 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1028 | 29964028 | 2018 | Selection of DNA aptamers to Streptococcus pneumonia and fabrication of graphene oxide based fluorescent assay | Lyd-2 | TGACGAGCCCAAGTTACCT-CACCCGCCTGGCAAAAAACACCACGACATTTTTCTCACCCCC-AGAATCTCCGCTGCCTACA | 80 | 5'-TGACGAGCCCAAGTTACCT-N42-AGAATCTCCGCTGCCTACA-3' (Library 1) and 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTTCACGGACCCCACT-3' (Library 2) | ssDNA | Streptococcus Pneumoniae | Whole cell | Identify aptamers that bind to and develop a graphene oxide/aptamer-based label-free fluorescent assay to detect Streptococcus pneumoniae and inhibit biofilm formation. | At 100 nM of Lyd-2, biofilm formation decreased to 92.6%. | 20 | Fluorescence Spectroscopy | 1984.8 ± 347.5 nM | Diagnostic/Therapeutics | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1029 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-12 | AGCAGCACAGAGGTCAGATG-GCGGGCGGGGGGAGGGCGGCCGTGGGCTGCGAGTGGGAGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | Limit of detection of 70 cfu/mL with a range of 70–7100 cfu/mL. | 12 | Flow Cytometry | 44 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1030 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-2 | AGCAGCACAGAGGTCAGATG-GTTCGGGGTCGGGGTGAGTGGGGCCTAGGAGTGGGGGCGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1031 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-8 | AGCAGCACAGAGGTCAGATG-ATGGGGGGCGGGGAGGTGGGTACAGGGTCGGGGATGGCAG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1032 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-10 | AGCAGCACAGAGGTCAGATG-CGGGCGGGGCGTGGGGTGTTGGAGTGGAGGGCGGGGCGGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 54 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1033 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-15 | AGCAGCACAGAGGTCAGATG-CAGGGTGCGGGAGGGCCAAAGGGGGGAGGGCCCGGGGGGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1034 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-21 | AGCAGCACAGAGGTCAGATG-GGGGGAGGCGCCGGGCAGGGGGCTCGGGGGAGGCGGGCGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1035 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-26 | AGCAGCACAGAGGTCAGATG-TTCAGGGCGGGGTAAACGGGAGGTGGGGGGGGCTTGGGAC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 130 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1036 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-28 | AGCAGCACAGAGGTCAGATG-TAATACTACCAACTTCTTTGCCTGGCGTAAGTAACAGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | 132 ± 18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1037 | 29698672 | 2018 | Selection and characterization, application of a DNA aptamer targeted to Streptococcus pyogenes in cooked chicken | S-32 | AGCAGCACAGAGGTCAGATG-TACACAATGCTTCGATAATTGACGCTACTTCATTTTATTA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Streptococcus Pyogenes (ATCC 49399) | Whole cell | Identify aptamers that bind to and develop an aptamer-based fluorescent bioassay to detect S. pyogenes in the cooked chicken. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1038 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A011 | CCAAGCUUGCAUGCCUGCAG-GGACUGUGGAUUGUUCUGGGUGCCGCUUCUCCGAAUAUCGGACUCUCGAACUCCUGGGGA-GGUACCGAGCUCGAAUUCCC | 100 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | 267 ± 48 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1039 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A036 | CCAAGCUUGCAUGCCUGCAG-GAUAUACGGUGCCGCUUCUCUAACCGGUGGUCAUGCGGUUGGACGCUCGAACAGACUA-GGUACCGAGCUCGAAUUCCC | 98 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1040 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT916 | CATCCGTCACACCTGCTC-GGCAAAAAGGATTGCCCAGGTCTGCTGTCTAGCCGGATTC-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | Detection limits of 2.1 ng/ml in buffer and 2.4 ng/ml in tap water, with a linear range from about 1 ng/ml to 1000 ng/ml. | 12 | Bead-based Affinity Chromatography | 48.5 ± 0.5 nM | Biosensor | SELEX | Amidation (NH₂-(CH2)6) or Biotinylated and AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1041 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT910 | CATCCGTCACACCTGCTC-GTACACAGGAGCCAAACCCAACCAGACCAACCTGAAGCC-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 54.6 ± 6.7 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1042 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT928 | CATCCGTCACACCTGCTC-CACCCGTCACACTTATCCGTCAACTGGGCTCCCACTGGG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 23.6 ± 1.2 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1043 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT931 | CATCCGTCACACCTGCTC-CCAGCGTGCGTCGAGGGGGACCCCTGTCAGCCCCCTCGCG-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 50.2 ± 13.2 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1044 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT938 | CATCCGTCACACCTGCTC-CACCCGTCCACTCATCCGTCACACCTGTTCTCCCCATG-GGTGTTGGCTCCCGTATC | 74 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 23.2 ± 0.4 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1045 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT939 | CATCCGTCACACCTGCTC-CACCCGTCACACTTATCCGTCACACTGGGCCCCACTGGG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 41.6 ± 4.0 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1046 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT943 | CATCCGTCACACCTGCTC-CACCCGTCCACTCATCCGACACACCTGCTCTCCCCACTG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 26.8 ± 0.5 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1047 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT946 | CATCCGTCACACCTGCTC-CCCACAACCGGTCCGGTGTTCGGTCCCCGTATCACGCCCC-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 30.4 ± 1.5 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1052 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H7 | Apt-1 | TGAGCCCAAGCCCTGGTATG-TTACAGTATGCTACCTCTACTTGAAGGTTGGTCGACGCGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 18.97 ± 1.73 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1053 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H8 | Apt-2 | TGAGCCCAAGCCCTGGTATG-TGATCGGTGACGAGGGTGCGGGGCGGGGGGTGAGGCACAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.73 ± 2.29 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1054 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H9 | Apt-3 | TGAGCCCAAGCCCTGGTATG-TAGTAATGGTGCGTACAGGCGACGGGGTCCAGGCTGGAGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 16.44 ± 2.16 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1055 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H10 | Apt-4 | TGAGCCCAAGCCCTGGTATG-AGCCCACGGAACACTGGTCGCGCCCACTGGTTTCTATATT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 15.13 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1056 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H11 | Apt-5 | TGAGCCCAAGCCCTGGTATG-CGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTT-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | Apt-5 shows a strong affinity for all stages of bacterial growth (adjustment, log, and stationary phases). | 14 | Flow Cytometry | 9.04 ± 2.08 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1057 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H12 | Apt-6 | TGAGCCCAAGCCCTGGTATG-GTGTGCCTGTCGTTGTATTGGTCGGTAGGGATCGGAGTGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 36.67 ± 4.55 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1058 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H13 | Apt-7 | TGAGCCCAAGCCCTGGTATG-TGTGGGGTCCTGGATTATGTTTAGCGTCTTTCGCAGTGGG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 17.11 ± 0.31 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1059 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H14 | Apt-8 | TGAGCCCAAGCCCTGGTATG-TCACATCCGGGTTCTTTGCGAACGCGTTTCCGCAGTCTCA-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 24.68 ± 1.95 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1060 | 29756774 | 2018 | Selection, Identification, and Binding Mechanism Studies of an ssDNA Aptamer Targeted to Different Stages of E. coli O157:H15 | Apt-9 | TGAGCCCAAGCCCTGGTATG-TTGCGGGAGTCTAGCGGGCCACACTTTTATAGGTTCGCAG-GGCAGGTCTACTTTGGGATC | 80 | 5'-TGAGCCCAAGCCCTGGTATG-N40-GGCAGGTCTACTTTGGGATC-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Identify aptamers that bind to different phases (adjustment phase, log phase, and stationary phase) of bacteria E. coli O157:H7 in the actual sample. | N/A | 14 | Flow Cytometry | 20.99 ± 0.37 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1067 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S1 | CAGTCCAGGACAGATTCGCGAG-TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | The limit of detection (LOD) was 1.46 × 10^3 CFU/mL, with a total detection time of 50 minutes. | 19 | Quartz Crystal Microbalance (QCM) | 10.30 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1068 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S2 | CAGTCCAGGACAGATTCGCGAG-GCGGGAATAGGATGCGGCTGGAAGGAGAGGTGTTGGTGGGTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1069 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S3 | CAGTCCAGGACAGATTCGCGAG-GTGCGGTGACGTGAGGGGGAGAGGCGTTGGTGTAGGCTGTTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1071 | 29766180 | 2018 | A nitrocellulose membrane-based integrated microfluidic system for bacterial detection utilizing magnetic-composite membrane microdevices and bacteria-specific aptamers | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A nitrocellulose membrane-based integrated microfluidic system for detecting bacteria. | Display a limit of detection as low as 450 CFU/reaction for AB within 40 minutes and a linear range from 4.5×10(4) to 4.5 CFU/reaction. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1073 | 29260861 | 2018 | Whole-Cell Pseudomonas aeruginosa Localized Surface Plasmon Resonance Aptasensor | Bt-aptamer | ATACCAGCTTATTCAATTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTGAGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | A localized surface plasmon resonance (LSPR) based sensing platform was developed to detect the whole-cell Pseudomonas aeruginosa strain PAO1. | Achieve a limit of detection (LOD) of 10 cfu/mL with a linear range of 10(0)–10(3) cfu/mL. | N/A | N/A | 17.27 ± 5.00 nM | Biosensor | Whole Cell-SELEX | 5′-Biotinylated Polyethene Glycol (Bt-PEG) thiol/PEG thiol (1:3) or 5'-6FAM-aptamer-Biotin-3' | N/A | Stable in ambient conditions for ≥2 months. | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1079 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA5 | TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 80 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 30.69 ± 7.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1095 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-01 | ATACCAGCTTATTCAATT-GGTCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1096 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-02 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.28 × 10(-10) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1097 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-03 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.25 × 10(-9) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1098 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-04 | ATACCAGCTTATTCAATT-TGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1099 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-05 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGGTTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1100 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-06 | ATACCAGCTTATTCAATT-GGGCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1101 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-07 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1102 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-08 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGACTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1103 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-09 | ATACCAGCTTATTCAATT-AGACAGCATAGCACTGTAACGATTGGTTTGGTGTGGTTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1104 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-10 | ATACCAGCTTATTCAATT-CCAGAATTGGTGGGTCGACTGCTGGTGTCCTATAAAGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1105 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-11 | ATACCAGCTTATTCAATT-CGTGGGCGGTAGAGCCAATGCTACTGGAGCGCGTATCCTA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1106 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-12 | ATACCAGCTTATTCAATT-GTCGGAGAGCCCGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1107 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-13 | ATACCAGCTTATTCAATT-GCGGACGGATAGTAAATAGCCCATGTACGCTGCTGGCGTC-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1108 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt1 | AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1109 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt2 | TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml. | 13 | Fluorescence Microscopy | 26.8 ± 5.3 nM | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1110 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt3 | ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1111 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt4 | AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1112 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt5 | GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1113 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt6 | GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1114 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt7 | AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1115 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt8 | ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1116 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt9 | TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1117 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt10 | TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1118 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt11 | GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1119 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt12 | GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1120 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt13 | TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1126 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S1 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGCTGGTGGCCATTGGCTCGTGTCTCGTTACTGCCGAGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | Exhibited a linear concentration ranging from 2×10(1) to 2×10(5) CFU/mL and LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1127 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S2 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGAATGACCTGGATTGACCCGTGAGTGTAGCATTTGTCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1128 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S3 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TTGACGATACGCAGGGGCGATACAGACAGTCTGCGTATTC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1129 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S4 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGTATCCCTCCTCGCTTCCATACCCAAACCGGACACACC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1130 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S5 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGCATGCACCTCACGCATCGAGCACTCACTCCTTCTACG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1131 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S6 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCTCCCGAGGACACACACACACCATCGCGGTACTCTCCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1132 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S7 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GCGCACCTCCGCCCTGTCGGGCGTCGTTTCCCCACGAATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1133 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S8 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTTTCCGTATGCGCAGCGCCATACACCTGTCTGATCTCCCC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1134 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S9 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTCGCAAGGACTCGATCTGGTGGTACCTGCTTTCCGTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1135 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S10 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGAGCACCAAGGATAGTTAGCGGTCGCCTTCACACTAGGC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1136 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S11 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 4.41 × 10(-12) M | Detection | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1137 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S12 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGTGGTGTTGACAATTGAACCTTTGCAGGGGTCTGGTGGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1138 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S13 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTGGAGGTGCGCTATAGGTCTCTCCGGGTACTGATCCAAT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1139 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S14 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCGACCCGTAACGCCAGTGAGGGAACACTCTGGAATAGTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1140 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S15 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGAGCAAACTGATAAACTCCGCCATGTCAGGCAAAGCTTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1141 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S16 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTTCGTTCCGTTGACATAATTCAATTTTGCGTATTTCTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1142 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S17 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-ATGGGGCTAGTCTACTTCTGTGTCTACCTAGGATTCCGCT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1143 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S18 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTAGGCGTAACCTCCTACTCTGTGCACTGTCTAAAGTGAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1144 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S19 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGCGGCGTACGCTATCTTGTAACCTCCCGAACTATAACCAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1145 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S20 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CAAGCGACTCGACCGTGGTACCTCCCCAATAGCCATTTGA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1146 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S21 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TCTCGCAGCCTCTTCCAATCTTGTTATTTACGCTTTCTGT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1147 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S22 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CACAAAGGAGCAAGAACTCAATTGCGCTCGTACCTTGTGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1148 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S23 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTAGCTGGGGTCCGGATCTGCGGTTCAGTGCGCTATTGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1149 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S24 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGACGGCTATCTCATTTGGCACATCATTTAGTAAGCTATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 3.75 ×10(-3) M | Detection | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1152 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#1 | ATACCAGCTTATTCAATT-CCATGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | VPCAapta#1 was significantly higher (798.41 ng/ul) than that of the other aptamer. | 11 | Surface Plasmon Resonance (SPR) | 2.04 ± 0.12 nM | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1153 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#2 | ATACCAGCTTATTCAATT-CCACGTTTCCACGTATCCTCGGAGCTTGCTTAACCGTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1154 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#3 | ATACCAGCTTATTCAATT-TGCGTAGTTCTTTTAACAACCATTCAGCGTATTTTCGTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1155 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#4 | ATACCAGCTTATTCAATT-CCCTCGGCGTAACTAGTACCGTTGCACCACCAACGTGATT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1156 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#5 | ATACCAGCTTATTCAATT-CGCAAGGGATTTCGGACCGGGCTTGGTCACACACAGAGCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1157 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#6 | ATACCAGCTTATTCAATT-CCAGCAGTGGGGCATGGGGGAACGATAAGATTATAAGGGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1158 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#7 | ATACCAGCTTATTCAATT-CACGCAAGCAGAAGCCACTCCCCCTGGTCGTACTATTTAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1159 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#8 | ATACCAGCTTATTCAATT-CACAGGCGTACCACTGCCCCAACGATCCTTTTGGTTACCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1160 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#9 | ATACCAGCTTATTCAATT-GTCGGAGAGCCTGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1161 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#10 | ATACCAGCTTATTCAATT-TGGAGAAGCGGCAGTTGATGCCTGGTACCCGTCTGCTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1162 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#11 | ATACCAGCTTATTCAATT-CGTAAAGGACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1163 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#12 | ATACCAGCTTATTCAATT-CGTAAAGAACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1164 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#13 | ATACCAGCTTATTCAATT-CGTAAGAACGCTGCCATGAATGTGCTATCCAGGCCTGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1165 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#14 | ATACCAGCTTATTCAATT-CAACGGAGGGAAGTTTCCATGTCCGGTACCAAGCGGTTTTTG-AGATAGTAAGTGCAATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1166 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#15 | ATACCAGCTTATTCAATT-GCACGGGAGGCACCCTGACATTGCAAATCCCATCGGTGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1167 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#16 | ATACCAGCTTATTCAATT-ACCTATAACAGCCATCATACGAGGTAATCCCCTCCCTCGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1168 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#17 | ATACCAGCTTATTCAATT-CCAACTGGATCTTACTGAGGAACGGTCCATTAGCACATCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1169 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#18 | ATACCAGCTTATTCAATT-CGCGACCACATCCTGCGTAAACACATCTCCGCCAGTCCAT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1170 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#19 | ATACCAGCTTATTCAATT-CGCAAGAGCAGCATACAGCACGAACGAGCCATTTACGCCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1171 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#20 | ATACCAGCTTATTCAATT-CGAAGACCAGACATGGTAGCCACGCATAGTCCAACTTAAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1172 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#21 | ATACCAGCTTATTCAATT-ACACCACACTAATGCATGCATTCTGTGAGTCACAGTTCA-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1173 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#22 | ATACCAGCTTATTCAATT-CACTCAAACCCAAACCATGCAAACTGAACAACGCAACACA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1174 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#23 | ATACCAGCTTATTCAATT-CACCAAACTGCCCAAATTTGAGGACGCCCTATACATGCG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1175 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#24 | ATACCAGCTTATTCAATT-GCCCAATACGTATGTTGATACATGCCCCTTACCCTTTGCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1176 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#25 | ATACCAGCTTATTCAATT-CACCGTAGTAAGTAAGCAGACGCTAAGGATGTTGCCAGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1177 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#26 | ATACCAGCTTATTCAATT-GTGACATGAACTGGTTTTCCACAGCTTAGGATCATGGATG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1178 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#27 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1179 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#28 | ATACCAGCTTATTCAATT-CCGTCGCTATAACCCTGTCTTTATATATCTTCGCCCACGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1183 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C5 | CCTAACCGATATCACACTCAC-GGCTAGCGGACAGGTGTAGGTCGGAATCCTTCAGCGTAGA-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1184 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C7 | CCTAACCGATATCACACTCAC-AGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGAC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1185 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C10 | CCTAACCGATATCACACTCAC-GTAGTGAGGTGGGTCGTGAAGGGAGGCACTACTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1186 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C13 | CCTAACCGATATCACACTCAC-GAGGTGAGGGTGCGAGGGTAAGGGGGCAAACCTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1187 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C16 | CCTAACCGATATCACACTCAC-ACGTAGTGAGGGTTGCGAGGGTAAGGTGGTCAGTATACGC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1203 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1 | CAGGTCCATCGAGTGGTA-GGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 3.1 ± 1.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1204 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G3 | CAGGTCCATCGAGTGGTA-TGCAGCGGACAGTGTGGGACCATCGCTGCGGATGTATGAA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 5.6 ± 2.4 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1205 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G7 | CAGGTCCATCGAGTGGTA-CCCAACCCACGATGCGCAAGAGGAATGCAGCCTACCAGCA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.6 ± 1.6 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1206 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1-T1 | TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG | 59 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | Achieved a detection limit of 1 nM. | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.5 ± 2.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1207 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G2 | CAGGTCCATCGAGTGGTA-CCGAGTTCCCAATATTATGGCTATGCAGGATACTTCACCT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1208 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G4 | CAGGTCCATCGAGTGGTA-TGAGTACTAGTTCCCCAGGAGAAAGCAGATCCCCAGGTAC-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1209 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G5 | CAGGTCCATCGAGTGGTA-GCACAGGACGCAAGATGAATGCAGCATACCAGTCCCTAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1210 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G6 | CAGGTCCATCGAGTGGTA-CAGCTGTCGACGCGTTACCGTGAACGGAACACCGATGACG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1211 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G8 | CAGGTCCATCGAGTGGTA-TGCGTGATTGGACCAGGGAAAGATGCACCGCAAGACAAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1212 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G9 | CAGGTCCATCGAGTGGTA-AGGATAATCCGATACGCAAGAAGAAAGCAGATTACCAGGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1213 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G10 | CAGGTCCATCGAGTGGTA-CAAAGTCGGCAAGGTGGAAAGCAGCCACACCACGACTAGT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1214 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10-Trunc | GGTGGTGGTGG | 11 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells. | 10 | Surface Plasmon Resonance (SPR) | 1.9 × 10−11 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611021901 |
| ABdb_1215 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS4 | GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.9 × 10−9 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1216 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS5 | GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.7 × 10−6 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1217 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS6 | GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.8 × 10−10 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1218 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10 | GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 1.2 × 10−8 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1219 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS20 | GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.1 × 10−7 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1220 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A16 | CCATCCACACTCCGCAAGTGGGGAGGGGAGAGACGACGATCCTGTGGGTTTTCTGCAGTGAGTCGTGTTTTCGACTTATTGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | 28.47 nM | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1221 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A46 | CCATCCACACTCCGCAAGTATGAGGACAGTTGGAGGGCGCGCCGTGTTTTTTCTGCAGTGAGTCGTGTTTCCTCGCTCACGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1222 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A1 | CCATCCACACTCCGCAAGTTTTAGGAGTAGTGGTGTGGGGACCGACTCTTTTCTGCAGTGAGTCGTGTTTTCGAGTCATCCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1223 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A2 | CCATCCACACTCCGCAAGTGAGATGTGGTGTAGGCAACTCGGCATAGATTTTCTGCAGTGAGTCGTGTTTTTTGACACGGCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1233 | https://doi.org/10.1021/acssuschemeng.9b01314 | 2019 | Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa Detection | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | An electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples. | Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1238 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp1 | AGTGTGCTCTTCTCAGGTCT-GTGGCCGGGGGCACTAATGCGGGCTATAAGTCTCCTTGGG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 35.60 ± 6.36 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1239 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp2 | AGTGTGCTCTTCTCAGGTCT-CCTATACCTGGCATCAGAGAGCTAGGGGCCACGGTTCGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | 204.38 ± 97.31 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1240 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp3 | AGTGTGCTCTTCTCAGGTCT-GGTGCTGCGATGCTTTCTGGTGGTGTATGGTTGTCTTTTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1241 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp4 | AGTGTGCTCTTCTCAGGTCT-CGGCGCGGTTGTGGGTACCTAGGGTTGTTGTTGCTTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | Hp4 had excellent binding to H pylori cells and almost no binding to E coli, S aureus, or V anguillarum. | N/A | Fluorescence Binding Assay | 26.48 ± 5.72 nM | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1242 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp5 | AGTGTGCTCTTCTCAGGTCT-GGGCTGTGGGTCGGCACGTCGTCTCTTCATGGTTGTGGTG-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1243 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp6 | AGTGTGCTCTTCTCAGGTCT-TTAGGGACCCATGGGCTAACCCGGGCACAAGATTGTCTCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1244 | 30950149 | 2019 | Recognition of Helicobacter pylori by protein-targeting aptamers | Hp7 | AGTGTGCTCTTCTCAGGTCT-ACACAACCTGCCGTATTGTAACCGTCGTCCCCCCGAAGCA-GCAGTGTCTCAGCATACGCA | 80 | 5'-AGTGTGCTCTTCTCAGGTCT-40N-GCAGTGTCTCAGCATACGCA-3' | ssDNA | Helicobacter Pylori | H. pylori surface recombinant antigens (HP-Ag) | Identify aptamers against H pylori surface recombinant antigens. | N/A | N/A | Fluorescence Binding Assay | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1258 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3P | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | Exhibits a wide linear detection range (from 10(2) to 10(7) cfu/mL), and the detection limit could be as low as 10 cfu/mL. | N/A | Flow Cytometry | 50.76 ± 8.92 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1259 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 32.53 ± 6.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1260 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A2 | GCAAAGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 37.44 ± 6.98 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1261 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3 | GCAACGAAACAGTGACTCGTTGA | 23 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 34.61 ± 3.47 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1263 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A5 | AACGAAACAGTGACTCGTT | 19 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 422.0 ± 21.93 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1264 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A6 | ACGAAACAGTGACTCGT | 17 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 412.9 ± 27.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1265 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-1 | CAACGAAACATTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1004 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1266 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-2 | CAACGAAACAGTTACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1103 ± 180.2 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1267 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-3 | CAACGAAACTGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 958.9 ± 183.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1268 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-4 | CAACGAAACAGCGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 73.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1269 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-5 | CAACGAAACAGTGTCTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1119 ± 187.1 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1270 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-6 | CAACGAAATAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 1070 ± 125.4 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1271 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-7 | CAACGAACCAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 423.2 ± 36.91 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1272 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-8 | CAACGATACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 467.0 ± 33.38 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1273 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4-9 | CAACGAAACAGTGAGTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 376.4 ± 54.25 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1283 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN12 | ATACCAGCTTATTCAATT-CCGAGTCCAGACTCACCGCCGCCTCCTCAAGACGTGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | GN12 was 3.6 times higher in binding to 10(8) cells of Gram-negative bacteria than to Gram-positive bacteria tested. | 12 | Fluorescence Binding Assay | 20.36 ± 2.38 nM (for E. coli DH5α), 24.80 ± 3.98 nM (for E. coli K12) and 53.83 ± 17.70 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1284 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA1 | GACGCTTACTCAGGTGTGACTCG-TCCATACCTCCTATTCCTATCTGATCACCATGAGCTCTCGCCTGAACTGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1286 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA3 | GACGCTTACTCAGGTGTGACTCG-TATCTTGTCAGCATATAGCCGCCCTGTCTCGTGCCTCTAATTGGGCTTGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1287 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA4 | GACGCTTACTCAGGTGTGACTCG-CTTGGTGGGGGGTGGCGGGTTGGTGATTAGTTGCGTGTACAACCGTTGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1288 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA5 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1289 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA6 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1290 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA7 | GACGCTTACTCAGGTGTGACTCG-GGGGCACTCTGGGGAAGGACGTAAGCGATAGCCGACCTCGTGGAATATTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1292 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA9 | GACGCTTACTCAGGTGTGACTCG-TCACCGTCATACACGGTCACCTGTTCTGCTATCACCCTGACGTGATTGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1293 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA10 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1294 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA11 | GACGCTTACTCAGGTGTGACTCG-TGGCGCAAGGGAAGGTGTTGGGGGATGGTTGGTGGGGTGTGTGGTTGTAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1295 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA12 | GACGCTTACTCAGGTGTGACTCG-ATGGCTGACTATATAAGAGAACGGGGGCTGCGGTGGTCCCGATCTGGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1296 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA13 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1297 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA14 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1298 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA15 | GACGCTTACTCAGGTGTGACTCG-TGGCGATGTACGCACCGCCCTCAGACTCATTCAGCATATAGCCTAGTAAC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1299 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA16 | GACGCTTACTCAGGTGTGACTCG-GGGGTGGATTGGGTGGGGTGGTTGGTTCGTTTTAAAGTACTGTGTAAGCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1300 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA17 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1301 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA18 | GACGCTTACTCAGGTGTGACTCG-GCTGCGTTAACATATAGGGCATTTGAGTGCGCGCATAGGGTTGTGGCGAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1302 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA19 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1303 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA20 | GACGCTTACTCAGGTGTGACTCG-TCCAGTCAGTATATAACTCCTCGACCCTGTGATCGGCTACGGTGGCAGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1304 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA21 | GACGCTTACTCAGGTGTGACTCG-GAGTGCTCGGTTGGTGTTGGGGGAGGGTGGTGGGTGACCATGCTACATGT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1305 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA22 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1306 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA23 | GACGCTTACTCAGGTGTGACTCG-GGGCGGGTGGACGGGGGTGGTATGGAGGTTGGAGTAAGCGGTTTCACCGA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1307 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA24 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1308 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA25 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1309 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA26 | GACGCTTACTCAGGTGTGACTCG-TCTGGTAGCATATAGCCGGCAGAGCACGGTCCCCTCATGGTTGGCACGTA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1310 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA27 | GACGCTTACTCAGGTGTGACTCG-GCCATGCTCACTATATAAGATATGTAAGTTGGACTACATATGTATGGCTG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1311 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA28 | GACGCTTACTCAGGTGTGACTCG-GCTGTGATCGTATGGACGCTGCAGTTGGATGACGCTATGAGGTATTCCAA-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1312 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA29 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1313 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA30 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1314 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA31 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1315 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA32 | GACGCTTACTCAGGTGTGACTCG-CACTATTGTCAAGTCACGAGTTAGGTACCTATGTGATCTGAGGTATCAA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1316 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA33 | GACGCTTACTCAGGTGTGACTCG-CTACTCAGGTGACCCTCAAACGTATCTAGTTTGGCAGCGAGGTTCCTTCG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1317 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA34 | GACGCTTACTCAGGTGTGACTCG-TTGCGAATATAGCGACGAGTATCGTCAGAGTCGCCGGGTCCAGGTTCGA-CGAAGGACGCAGATGAAGTCTC | 94 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1318 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA35 | GACGCTTACTCAGGTGTGACTCG-GGTGGTGGGGATTTGGGGTGGTTGGTTCATCTATCTGGTCGTTACCGGGG-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1319 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA36 | GACGCTTACTCAGGTGTGACTCG-CGCGGCACCAGCACGACGGTTCGATTGGCTGCGGAAACCACGCACTGCAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1320 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA37 | GACGCTTACTCAGGTGTGACTCG-GGTGTTGGTGGGTGGCGGGGTGGTGGTTGGTGTTCCCGAACCTGATGAAT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1321 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-1 | ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | N/A | 8 | Flow Cytometry | 21.1 ± 2.7 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1322 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-2 | GGCTCACCTACAGGCTGCGGAGTCATAGCATCGTGACAGAGTCGAGTGTCGACTATACGT | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 19.3 ± 3.7 nM | Detection | Whole Cell-SELEX | 3'-Biotinylated (biotin-AAAAAAAAAA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1323 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-3 | TCGAAGTGAGCGCGCGGTGTGGTGACTGTGTTGCAGATGGATGCATGGAGGTGATGATGA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | Achieved a detection limit of 10(5) cfu/mL and selective detection of L. casei in commercial dairy drinks, with a dynamic range of 10(5) to 10(9) cfu/mL. | 8 | Flow Cytometry | 15.6 ± 4.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1341 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | A1 | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Acinetobacter Baumannii | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(3) for AB. | 3 | Fluorescence Spectroscopy | 6.8 ± 1.9 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1342 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | E27 | ACAGCACCACAGACCACAGATCATACCAGTGCGGCCGTTAGCCTCGTTAATCTGGCGTTTGTCTTCCTGCC | 71 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(4) for EC. | 3 | Fluorescence Spectroscopy | 11.9 ± 3.7 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1346 | https://doi.org/10.1016/j.foodcont.2018.11.048 | 2019 | Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor | Sh. flexneri binding aptamer | CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG | 40 | N/A | ssDNA | Shigella Flexneri (ATCC 12022) | Whole cell | Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri. | Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less. | 14 | N/A | 42.6 ± 7.11 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1349 | 31953175 | 2020 | Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | SipA protein | Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion. | 70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively. | 9 | Fluorescence Spectroscopy | 114.9 nM (at 27°C) and 63.4nM (at 37°C) | Therapeutics | Magnetic Bead (MB)-based SELEX | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1367 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains. | 10 | Flow Cytometry | 116 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1368 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C1 | GCAATGGTACGGTACTTCCCCACCCCACGCTGCTCCCAAAAGTGCACGCTACTTTGCTAA | 60 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | R10C1 shows significantly more binding to Lp than to Pseudomonas. | 10 | Flow Cytometry | 135 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1393 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF508 | TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells. | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 37 ± 4 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1405 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 1 | ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1406 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 2 | ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10(3) CFU/mL. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1407 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 3 | ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1408 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 4 | ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1409 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 5 | ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1415 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V8 | AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell (Cell wall protein) | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL. | 13 | Flow Cytometry | 11.22 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1416 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V9 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1417 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V11 | AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1418 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V12 | AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1419 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V13 | AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | 15.47 ± 0.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1420 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V18 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1421 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V20 | AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1422 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V28 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1423 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V31 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1424 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V38 | AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1425 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V39 | AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1426 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V40 | AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1427 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V41 | AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1428 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V44 | AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG | 65 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1429 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V49 | AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1430 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V53 | AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1431 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V59 | AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1432 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V69 | AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1433 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V71 | AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1434 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV8 | CAATCATGACCGCCCACCTCACTCG | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 17.44 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1435 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | TV13 | CCAACCCTATGCTTCAACGGTCTTT | 25 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The fluorescent intensity of V. vulnificus was significantly greater than that of other species. | 13 | Flow Cytometry | 13.21 ± 2.19 nm | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1467 | 32980107 | 2020 | A novel method combining aptamer-Ag10NPs based microfluidic biochip with bright field imaging for detection of KPC-2-expressing bacteria | XK10 | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | N/A | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a PDMS/glass microfluidic biochip integrated with aptamer-modified Ag(10)NPs nano-biosensors to detect whether bacteria express KPC-2. | Detects the target bacterium with a detection limit of 10(2) CFU and a capture efficiency exceeding 90% in ∼1 h. | 8 | Surface Plasmon Resonance (SPR) | 0.81 nM | Biosensor | Protein SELEX and Whole Cell-SELEX | 5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1476 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap1 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 18.10 ± 6.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1477 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap2 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 13.38 ± 3.8 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1478 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap3 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 11.46 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1479 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap4 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 14.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1480 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap5 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 21.78 ± 9.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1481 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap6 | TAGGGAAGAGAAGGACATATGAT-GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC-TTGACTAGTACATGACCACTTGA | 88 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | The detection limit of this aptasensor was as low as 10(5) CFU/ml within 10 minutes and a linear range of 10(5)-10(8) CFU/ml. | 10 | Flow Cytometry | 9.82 ± 3.6 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1482 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap7 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.85 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1483 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap8 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.90 ± 17.4 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1484 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap9 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1485 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap10 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.85 ± 12.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1504 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-10 (truncated) | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | The detection limit of Biotin-XK-10 was 104 CFU/mL, and that of Biotin-Ag-XK-10 was 103 CFU/mL. | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | 0.81 ± 0.13 nM (by SPR) and 12.9 ± 1.03 nM (by microarray chip) | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1505 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-1 | ACCCCATATCGCGTCAAATTTGGCTACCTCACATGCCCAC | 40 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1506 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-2 | GACAGGCAGGACACCGTAAC-AAGCCCGTGCGGCTTCGTGCGATGGATACAGTGGGCGGGG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1507 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-3 | GACAGGCAGGACACCGTAAC-ACTAGTAACCCCTAACATCTTCCGCGTTCTTATAGGCCCC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1508 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-4 | GACAGGCAGGACACCGTAAC-ACTCCATGGGGTTTGTAGGGCTCGCTGTAATTATACTTTA-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1509 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-5 | GACAGGCAGGACACCGTAAC-ACTCCCCCTTCCCTGTCTGCTCTACCTGCCTGTTCCCTGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1510 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-6 | GACAGGCAGGACACCGTAAC-AGGTTGTTGCCGCTCCCCTCGTCTGTTGGGGGTTGTCCTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1511 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-7 | GACAGGCAGGACACCGTAAC-ATAACTTCTCTCCCGTCAGTCTCCGCAGCCCCATTCCATC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1512 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-8 | GACAGGCAGGACACCGTAAC-ATCGCAGGGCCCCCGTTATTATTCCCCACTTCCTTCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1513 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-9 | GACAGGCAGGACACCGTAAC-CGGGCTTATCGGTCCGTCTGGAAGGTCCTTTCCTATTCGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1514 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-10 | GACAGGCAGGACACCGTAAC-GGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1515 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-11 | GACAGGCAGGACACCGTAAC-GGGTATACAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1516 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-12 | GACAGGCAGGACACCGTAAC-GGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1517 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-13 | GACAGGCAGGACACCGTAAC-GGGTACGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTG-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1518 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-14 | GACAGGCAGGACACCGTAAC-GTACTGCCTCCCTCCTGCCGTCCCTCTCTCTAGTCTCTGC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1519 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-15 | GACAGGCAGGACACCGTAAC-GTCCGCCTCTGTATTCCTGCCTCTGTTCCTGCCTTCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1520 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-16 | GACAGGCAGGACACCGTAAC-TATACCTTCCATCCCGGTCCTGCTCCTCGTCTTTTGTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1521 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-17 | GACAGGCAGGACACCGTAAC-TCCCACCTCTTCCCCCCTTCTAGGTTCATCTCGCGCCACC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1522 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-18 | GACAGGCAGGACACCGTAAC-TCGTCATTCGTCATTCCTGCCCTTTCCTGCCTGATCTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1523 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-19 | GACAGGCAGGACACCGTAAC-TGCCCTCCCTTCCTGCCTGGTCCTGCCGTATTATTTTGTC-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1524 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-20 | GACAGGCAGGACACCGTAAC-TTTCCTGTATTGTGGAAGTAAACGTCTGAGTGGTCGATGT-CTGCTACCTCCCTCCTCTTC | 80 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1525 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-2 | AAGGAGCAGCGTGGAGGTTA-CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | Limit of detection (LOD) of HPA-2 was 88 cfu/mL. | 9 | Fluorescence Spectroscopy | 19.3 ± 3.2 nM | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1526 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-1 | AAGGAGCAGCGTGGAGGTTA-CGCCTGATCCAGGTGCTATCTTCCGCCCTGTTTCTTTGGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1527 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-3 | AAGGAGCAGCGTGGAGGTTA-CTCCTCGGTCCTTTCAGGTAGACGCTCTTACGCCCTCAGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1528 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-4 | AAGGAGCAGCGTGGAGGTTA-CGTGTATCCCCTGTGTGTTTGTACTCGGCTACTGTATCCG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1529 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-5 | AAGGAGCAGCGTGGAGGTTA-CTCGTTTGGATACGTCATCGGTAGGACTACGGTACCTAAAC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1530 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-6 | AAGGAGCAGCGTGGAGGTTA-GCACAGGAGACAGGGGGAGATGATACTCGGCGTTTCAAGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1531 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-7 | AAGGAGCAGCGTGGAGGTTA-CTCGCGCCCTTCTTTCAGTAGCAGTGTACGGATCTTGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1532 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-8 | AAGGAGCAGCGTGGAGGTTA-TGCATATCGCTAGCTGATAAGCTGATGCCATCGTGTCTAC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1533 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-9 | AAGGAGCAGCGTGGAGGTTA-GCATCTTTGAGGAATTTTCGTCAAAGGACCGAGTAACGGC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1534 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-10 | AAGGAGCAGCGTGGAGGTTA-AGTTGCTCTTGATCGTCGACCAGTCGCTATGCAGCACCCC-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1535 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-11 | AAGGAGCAGCGTGGAGGTTA-CTGCACGAATGATCCCCCGCCATGCTGTAGTTCCGTCTTA-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1536 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-12 | AAGGAGCAGCGTGGAGGTTA-CTGTAACGCCCCGCTGATTCTTTCTCAGCGTGCTAGGCGG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1537 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-13 | AAGGAGCAGCGTGGAGGTTA-ATCGCTCCGTCCAGTAAGAGTTGCCTACAATGCCCGCCGGC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1538 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-14 | AAGGAGCAGCGTGGAGGTTA-CAAATGAGCCTTAGAGCTGTGCAGAGTTCGAAGCTTGGTG-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1539 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-15 | AAGGAGCAGCGTGGAGGTTA-CCTCGGTGTTCGTTCTGACTACGTTCCCTGGGACCCGCGT-ACCACGACGACACACCCTAA | 80 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1570 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI05 | TAGCTCACTCATTAGGCACGACTCACTCTTGAAGGGGTGAGGCATGGTGGTATCAGCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 144.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1571 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI08 | TAGCTCACTCATTAGGCACATGCACCGAGGTCAGAAGTGCCTGTAATACACACCCCTCGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 301.4 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1572 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI 9 | TAGCTCACTCATTAGGCACCGAGTGCAAGATGTCCTACCCGATGAAGTAGGTTGGGTCTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 279.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1573 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI23 | TAGCTCACTCATTAGGCACCTTGGCTTAAAATGATAGCTAGTGGCAGATTGTTAATTTGGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | The assay is able to detect 10(2) CFU/mL cells. | 10 | Flow Cytometry | 231.2 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1576 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI37 | TAGCTCACTCATTAGGCACGAACGGGCTTGTCTTTCCATAATTCGTGCGAAAGTGCCGCATAGTTAAGCCAGCC | 74 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 176.7 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1577 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI42 | TAGCTCACTCATTAGGCACTAGCGGAAGCTTAGTGTAAACGAGTGATAATGTGTTATGTGCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 173.6 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1599 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E1 | TAGGGAAGAGAAGGACATATGA-CGATTACCGGAGCTGTGTCACCGGGCGCCAGTTGATGTGG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1600 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E2 | TAGGGAAGAGAAGGACATATGA-TATGATGGGAGTAACGATTGTCCGACATGGTACCACCCCA-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1601 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E3 | TAGGGAAGAGAAGGACATATGA-GGTGCACCTCTCGCCCGAATCAGATCCCCACGGCGCCCCCTA-TTGACTAGTACATGACCACTTGA | 87 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1602 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E4 | TAGGGAAGAGAAGGACATATGA-ATCGGCTACGAGGTCCCGACTGCCGGACTGGCCCTTGGTC-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1603 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E5 | TAGGGAAGAGAAGGACATATGA-ACACCGCCACGATGCAACTGCCAAACGCACCGTACGCCTG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1604 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E6 | TAGGGAAGAGAAGGACATATGA-CGAGAGGCCGCTGGGTCTAGACGTCCGGGTGCCACTCGCG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1605 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E7 | TAGGGAAGAGAAGGACATATGA-TAACGCCTGTAGTACTCCACCTTAATCCGTTGCCAGGAAT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1607 | 35846753 | 2022 | Selection and Identification of a DNA Aptamer for Multidrug-Resistant Acinetobacter baumannii Using an In-House Cell-SELEX Methodology | A01 | CAGGGGACGCACCAAGG-TTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTT-CCATGACCCGCGTGCTGCGTGA | 74 | 5'-CAGGGGACGCACCAAGG-N35-CCATGACCCGCGTGCTGCGTGAT-3' | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Identify aptamers against MDR A. baumannii. | Preferential binding to A. baumannii over other species. 25% of positive events for A. baumannii above the 12.66% of the negative control. | 7 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | Aptamer binding does not seem to interfere with the A. baumannii cell growth even after 24h (5.88E+02 x 1.45E+03; p=0.700). | N/A | N/A | N/A | N/A |
| ABdb_1608 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su12 | GGGAGUCGACCGACCAGAA-CAUACUGAGUAAGAUCGGAAAUUUCGGUGUAAGGCCACGG-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | Significantly reduced biofilm formation by 61.2%. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1609 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su057 | GGGAGUCGACCGACCAGAA-UGGAUGUAUGGAACUUGCAGAUCUUAACUGCACGAAGCGU-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1610 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su15 | GGGAGUCGACCGACCAGAA-ACACGUUGCUGAAACAUACCGAGUAACAUAAAGCGGGUG-UAUGUGCGUCUACAUCUAGACUCAU | 83 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1612 | 35616277 | 2022 | Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complex | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGAGACAGCGCGGGAGGCACCGGGGAGATCCGGGCCTCATGTCGAA | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Penicillin binding protein 2a (PBP2a) | Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms. | The linear range was 10^3–10^7 CFU/mL, and the detection limit for the fluorescent assay was 800 CFU/mL. The inhibition rate peaked at 92.8% after treatment with the GO-berberine/aptamer 1 (containing 200 nM aptamer 1) complex. | 14 | Fluorescence Spectroscopy | 82.97 ± 8.86 nM | Diagnostic/Therapeutics | SELEX | FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1613 | 35616277 | 2022 | Targeted inhibition of methicillin-resistant Staphylococcus aureus biofilm formation by a graphene oxide-loaded aptamer/berberine bifunctional complex | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAAGGCACACAGGACTATACAGTGTTGCAGTGTTGCTGGATCCGGGCCTCATGTCGAA | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Penicillin binding protein 2a (PBP2a) | Identify a PBP2a-targeted aptamer in conjunction with GO for the delivery of berberine to treat chronic infections caused by MRSA biofilms. | N/A | 14 | Fluorescence Spectroscopy | 152.92 ± 29.26 nM | Diagnostic/Therapeutics | SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1629 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt1 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | Display a linear range between 7.0 × 10(4) and 7.0 × 10(7) CFU/mL, and the limit of detection of SWV was 7.0 × 10(4) CFU/mL. | 8 | Fluorescence Spectroscopy | 11 nM | Biosensor | Whole Cell-SELEX | FAM Labeled and Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1630 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGTGTACGTATCATTTATGCTTTAATAGTGTGCCGTTGTTGCTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1631 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt3 | ATCCAGAGTGACGCAGCA-TGACGGGTAGGACTTCCTGTGTTAGGTTGTAATGTTGGTGAAGCGTCCCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1632 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt4 | ATCCAGAGTGACGCAGCA-TGGGGCCGGACAGGGCAAACTGGCTGAAGCGGAGGGTGTCGGCGCCGCTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1633 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt5 | ATCCAGAGTGACGCAGCA-TGAGGGGAGGTAAGGGGTGAGCTCGCATGTACCGTTGGGAGAGGGGGGGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1634 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt6 | ATCCAGAGTGACGCAGCA-TGTGGGCAAGTCGGTGACGAACCAGGTGTCAAGGTCCTGCGCGCTCGCAC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1635 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt7 | ATCCAGAGTGACGCAGCA-TGGAGCGGTGGGCACGGTTGGGTCGCGTGGATGGAGGCGGGCGTGTGCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1636 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt8 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1637 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt9 | ATCCAGAGTGACGCAGCA-CGAACGTTAGACGATTTGTGCAGTAGTGGCCACAGCCTAATCGTGTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1638 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt10 | ATCCAGAGTGACGCAGCA-TGCCAGTATGCCCACTCTCATTCGGCTTCTTTGTGTTGCATGTTACGCCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1642 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-59 | CATGACACCGTACCTGCTCT-TGCTTTTCGTGCGCGCATAAAATACCTTGATACTGTGCCGTATGAAAGCG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | OspA limit-of-detection determined to be 1 × 10−4 ng/mL with 91% sensitivity and 96% specificity. | 10 | Fluorescence anisotropy (FA) | 2.18 nM | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1643 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-21 | CATGACACCGTACCTGCTCT-AATAAGCACGCCAGGGACTATTAGATCGGAATAGCACACGTCTGAACTCC-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1644 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-46 | CATGACACCGTACCTGCTCT-AATAAGCACGCCAGGGACTATTAGATCGGAAGAGCACACGTGTGAACTCC-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1645 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-22 | CATGACACCGTACCTGCTCT-ACGAGATTCAAGCACTCCAGGGACTATTAGATCGGAAGAGCACACGTCTG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1646 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-39 | CATGACACCGTACCTGCTCT-ACGAGATTCAAGCACGCCAGGGATTATTAGATCGGAAGAGCACACGTCTG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1647 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-55 | CATGACACCGTACCTGCTCT-TGCTTTTCGTGCGCGCATAAAATACTTTGATACTGTGCCGGATGAAAGCG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1664 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR22 (APT-1) | GTCTTGACTAGTTACGCC-CTGCTGGTCTTTAGTCTCTATTGAGTGGCTAAAGTTGAGGCAG-TCATTCAGTTGGCGCCTC | 79 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | Identify an aptamer against DevR and inhibit DevR-dependent transcription by blocking DevR dimerisation and DNA-binding activity in Mycobacterium smegmatis. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1665 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR25 (APT-2) | GTCTTGACTAGTTACGCC-CTGCCTTTTCAAAAGTTTATTGGGATGTACTTTTGTTCAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1666 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR28 (APT-3) | GTCTTGACTAGTTACGCC-CATAAACGCAGTGACGTTCCCAGAATTGTGGCTGATGATTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | N/A | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1667 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR10 (APT-4) | GTCTTGACTAGTTACGCC-GCGAGAATGTGCGCAAAGTCTCATGTCAGTATGTGGTCTTTTCG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-4 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 61% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1668 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR16 (APT-5) | GTCTTGACTAGTTACGCC-CTGCCTTGGCTCGAAGGGGTGATGAGAAGTAGGCGGGAAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1669 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR28 (APT-6) | GTCTTGACTAGTTACGCC-CGAGGGGAAGGATGGGGTGGAGGGAGGTGGGGGAGGGTTGGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-6 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 66% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 4.724 nM | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1670 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR29 (APT-7) | GTCTTGACTAGTTACGCC-CCCAAGAACCCGCTCGCCGTGGTGACGTCGATCATGCCTTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1673 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC1 | GGGGTCATAGTATCCTAGTTG-AATGATGACATTCCGAGGTACCCAGAGTGCGATACTAACCGGCCTGCTTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 1.165 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1674 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC2 | GGGGTCATAGTATCCTAGTTG-CTCGCGCGCCCAATGTTTGCATCGATCTGATGGGCATAACGGCCTTGAAT-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 10.26 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1675 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | EC3 | GGGGTCATAGTATCCTAGTTG-CCGACGAGACTTCCACAACGCTGCCAAGCCATCGTCCCCCCGCACTCAGG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 3.17 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1676 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM1 | GGGGTCATAGTATCCTAGTTG-CCGCCCGTAGAGGATTGTAGCCGCCTTTCGCCAACCTAAACCGAGACCTG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 38.3 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1677 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM2 | GGGGTCATAGTATCCTAGTTG-TCGTTCATCTGAGCTCCTGGTATCGCGTGTGTATACGAGCCTCACATTCA-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 9.03 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1678 | 35700936 | 2022 | SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers | LM3 | GGGGTCATAGTATCCTAGTTG-CCGTCCCGGTAGTCTGAGCTTACAATGTCTGATTGGAAATGCACACCAAG-CCTGTAATTTATCTTCTGGAGCT | 94 | 5'-GGGGTCATAGTATCCTAGTTG-N50-CCTGTAATTTATCTTCTGGAGCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Lipopolysaccharide (LPS) | Identify aptamers that bind to LPS on Gram-negative bacteria and inhibit the LPS-induced inflammatory response, thereby inhibiting bacterial infections. | When aptamers bind to the LPS, the macrophage polarization ability of LPS can decrease, and the secreted nitrite level diminishes. | 8 | Flow Cytometry | 8.89 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1686 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 28,06 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1687 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1688 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 31,99 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1689 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5,21 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1690 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 8,89 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1691 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1692 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,84 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1693 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1694 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,79 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1695 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,53 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1696 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 45,36 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1697 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1701 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-1 | CCGGAATTCCTAATACGACTC-TGCGGACTGTATCGGTCGGTCGAAAATAGTGAAGTGC-TATTGAAACGCGGCCGCGG | 77 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1725 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA37 (SA-10R-37) | GCTTCCAGCTTATTGAAT-AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 16.5 ± 3.41 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1726 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA81 (SA-10R-81) | GCTTCCAGCTATTGAA-AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG-GCGCTGAAGCGCGGAAGC | 75 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 14.47 ± 8.18 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1727 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA25 (SA-9R-25) | GCTTCCAGCTTATTGAAT-GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 44.92 ± 1.36 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1728 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA28 (SA-10R-28) | GCTTCCAGCTTATTGAAT-GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 77 ± 1.22 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1729 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA35 (SA-10R-35) | GCTTCCAGCTTATTGAAT-CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG-GCGCTGAAGCGCGGAAGC | 74 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 58.77 ± 0.73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1730 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA40 (SA-10R-40) | GCTTCCAGCTTATTGAAT-CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 126.95 ± 0.51 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1731 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-12 | GCTTCCAGCTTTATGAAT-TGGGCGTGGCGACGGTGTCAGGTCGGGGCGGTAAGACGAGG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1732 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-57 | GCTTCCAGCTTATTGAAT-GGAACGAGATGGGGCATGGCGCCACGGAGGGGAATCAAGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1733 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-1 | GCTTCCAGCTTATTGAAT-CGAGGGTAAGGGAAGTATGGCCGGTGCCCTGGAGTCAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1734 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-18 | GCTTCCAGCTTATTGAAT-CGGGTGGGGGGAGCGACAGACGGAAAAGCCTGGGTCAATAG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1735 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-55 | GCTTCCAGCTTATTGAAT-GGAGGGGCAGGGCATGGAGCTCGACATTCATGAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1736 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-59 | GCTTCCAGCTTATGGAAT-GTGCCGAGGCGATACATGCACAGGCATGGTGGGATAAGGTCGGG-GCGCTGAAGCGCGGAAGC | 80 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1737 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-69 | GCTTCCAGCTTATTGAAT-CGGAGAGTCTGGCGCAGCCCTACGCCGATGTAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1738 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-72 | GCTTCCAGCTTATTGAAT-CGAGGTGTGGGAGACAACGCTCCGTGACCGAGGGGAAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1739 | https://doi.org/10.1016/j.snb.2021.130933 | 2022 | Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophila | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | N/A | ssDNA | Legionella Pneumophila (Lp) strain Lp02 | Whole cell | SPRi-based titration assay using Lp aptamer for detecting L. pneumophila. | The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1748 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | 214.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1749 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1_RC | ATCCAGAGTGACGCAGCA-GCGGCAGCCACCCAACGACCACGCTCATCCTCCTCCCCCGCACCGTCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | Using SWV, exhibiting a linear detection range of 4.0 × 10(4)–7.0 × 10(7) CFU/mL, and a limit of detection of 4.0 × 10(4) CFU/mL at pH 5.0. | 8 | Fluorescence Spectroscopy | 3.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled and Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1750 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGGGGCATGGGAAGGTGGGTAAGCCGTTGCGTGGGATGTGGCGGGTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1751 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2_RC | ATCCAGAGTGACGCAGCA-GACCCGCCACATCCCACGCAACGGCTTACCCACCTTCCCATGCCCCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1752 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3 | ATCCAGAGTGACGCAGCA-TGGGGCGAAGGACGGTGGATGTGTGTAGGCGCGGGTGGGTCGCACGGGGT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1753 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3_RC | ATCCAGAGTGACGCAGCA-ACCCCGTGCGACCCACCCGCGCCTACACACATCCACCGTCCTTCGCCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1754 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1755 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4_RC | ATCCAGAGTGACGCAGCA-CAGCGCGCGCTTCTCACTCCCCGCCCCCGTCGTGTCTCTCCCGTCTGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1756 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5 | ATCCAGAGTGACGCAGCA-TGTGGCGGTGGCAAGGTCGGTGGGTGCGGCGGCGTACCGGTGGTGGGGGG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1757 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5_RC | ATCCAGAGTGACGCAGCA-CCCCCCACCACCGGTACGCCGCCGCACCCACCGACCTTGCCACCGCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1758 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6 | ATCCAGAGTGACGCAGCA-TGACCGGCGGGGGGTGGTTCGCTGATAGGGCGTGTGGACCGGGGGTCGCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1759 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6_RC | ATCCAGAGTGACGCAGCA-TGCGACCCCCGGTCCACACGCCCTATCAGCGAACCACCCCCCGCCGGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1760 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7 | ATCCAGAGTGACGCAGCA-TGGGCGGGTAGTGGGGCAACGTGAGCGCGTGGGGTGTGGCAGGCGTGGCT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1761 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7_RC | ATCCAGAGTGACGCAGCA-AGCCACGCCTGCCACACCCCACGCGCTCACGTTGCCCCACTACCCGCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1762 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8 | ATCCAGAGTGACGCAGCA-AGATGACTTAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1763 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8_RC | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTAAGTCATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1764 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9 | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCATCGAGTGTA-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1765 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9_RC | ATCCAGAGTGACGCAGCA-TACACTCGATGACACACTCTTTCCCTACACGACGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1766 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10 | ATCCAGAGTGACGCAGCA-TGGGTGTGGTGGCGCGGGTGGCGTGGTGCGTGTACAGCTGGTTGCGGGCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1767 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10_RC | ATCCAGAGTGACGCAGCA-CGCCCGCAACCAGCTGTACACGCACCACGCCACCCGCGCCACCACACCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1789 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP1 | GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1790 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP2 | CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG | 48 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1791 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP3 | TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL. | 10 | Fluorescence Spectroscopy | 133.13 ± 22 nM | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | Patent Application No. 202241038353 |
| ABdb_1801 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B3 | AGCAGCACAGAGGTCAGATG-AGGCCCGGGTTTGGTTCTGGGGTTGGCGGGCTGCGTGAGC-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1802 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B4 | AGCAGCACAGAGGTCAGATG-GAAGGGTTTGGTGGTAAATTGCGTGGTTGGCTGTTGATGG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1803 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B6 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCTTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1804 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B7 | AGCAGCACAGAGGTCAGATG-TCGGTCGGGTTTGGGTGTTGGTTGGCGATAAAGATAACTG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 19.64 ± 4.11 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1805 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B11 | AGCAGCACAGAGGTCAGATG-GTGTAGGTCAATCGACGCCACCCATAGCAACCATCCTGCG-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1806 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B14 | AGCAGCACAGAGGTCAGATG-GTGGGCAGTGGGGGGAGGGGGAGGTGGAGGTTAGACGTGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | N/A | 16 | Flow Cytometry | 28.64 ± 3.10 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1807 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B15 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 16.13 ± 4.98 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1808 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B16 | AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 20.67 ± 5.23 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1810 | 37437266 | 2023 | Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor | KPBA1 | GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG | 64 | 5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3' | ssDNA | Klebsiella Pneumoniae (MTCC-7028) | Whole cell | Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae. | LoD as low as 3.4 × 10(3) CFU/mL within 5 min. | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1856 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab1 (A00) | TGGTGCGTGCTATTCAGAGT-GAGGGACGCATGATTGGGTGACTCCGGGAGATCATGCAAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 14.12 ± 2.31 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1857 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab2 | TGGTGCGTGCTATTCAGAGT-GGGGTGGACCGGGGGGATCGAATAACGCATCGCGCCTAGT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 26.26 ± 9.87 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1858 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab3 | TGGTGCGTGCTATTCAGAGT-CCTCTAGGCGGTAAGGATCGGACCTTGGTCTGATGGTGAG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 66.51 ± 24.28 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1859 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab4 | TGGTGCGTGCTATTCAGAGT-GACGGATACGGATTCAGGGCGGAGTGCCAAGATACGGATG-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 97.98 ± 37.42 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1860 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | Ab5 | TGGTGCGTGCTATTCAGAGT-GTTGAGGATTAGGATCGCTTTAAACGATTAGGATCCGAAT-GAACCTGTAGCCACGAATAC | 80 | 5'-TGGTGCGTGCTATTCAGAGT-N40-GAACCTGTAGCCACGAATAC-3' | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 142.2 ± 39.3 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1861 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A01 | GCGCGGGCTATTCAGAGTGAGGGCCGCGTGAGCGGGCGACTCCGGGAGATCGCGCGCG | 58 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 27.91 ± 13.34 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1862 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A02 | GAGCGGGCGACTCCGGGAGATCGCGCGCGG | 30 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 6.86 ± 5.77 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1863 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | A03 | CGACTCCGGGAGATCG | 16 | N/A | ssDNA | Aliarcobacter Butzerli (ATCC 49616) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 19.33 ± 9.76 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1864 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C00 | GTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCATGTCCTGAGACTCATGTCTGCTGTCAATCGCAAGGTCCA | 77 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 48.12 ± 6.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1865 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C01 | CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG | 38 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 27.69 ± 5.66 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1866 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C02 | CGCGAGTCTGCTGTCAATCGCAAGGCGCG | 29 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 61.58 ± 19.805 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1867 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C03 | CGCTGTCAATCGCG | 14 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 240.2 ± 106.85 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1868 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C04 | GCGTCCATGTCGC | 13 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | N/A | 12 | Fluorescence Binding Assay | 259.8 ± 55.1 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1873 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 3 (Ap3) | NNNNNNNNNNNNNNNNNNNNNGGGGGCTTTCAAGGGCGCGACGAAGCTGTTTTATTCTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | Achieved a detection limit of 0.1 ag/mL EC proteins (equivalent to 3 protein particles per mL) within 120 min from the plasma sample. | 15 | Isothermal Titration Calorimetry (ITC) | 8.30 x 10-7 M | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1874 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 1 (Ap1) | GACGTTTTGCAAGTGCGGCTACTACAAGCGAAGTTCCATCATTTTAGAGTCATAAACGC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1875 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 6 (Ap6) | CCGCCTGGAAGGCATTTCGCCGGGAAGACCCACGTCACTCCTCCCCTGAACTTCGGTTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1876 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 2 (Ap2) | TATACATTGATTTATCGGACCACTGCAGTACCACGCAGGATGGACGGCCATCGTTAATA | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1877 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 4 (Ap4) | TAGGATTCGTTTATTCGTGGGGCTGTAGTTCCGATAAAACCGCCAAGGGATCGTTGCCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1878 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 5 (Ap5) | ATTAGATGTAAAACGCCACGGGTAGCAGTTAAAGTCGTATTTATAGGCACAACGAAGAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1879 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 7 (Ap7) | CAATTAGACAGGCTCTAAGCTTTGGACCCAGCGTAGAAAGTTTGTTATTTCTTCGGGCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1880 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 8 (Ap8) | ATAAGCTTTTTAAGGCAAGGACGCGGCCCGGTACTTGCGTTGGAGGAATCTTAAGTTAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1881 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 9 (Ap9) | CATTTATAACTACGATTGTGGTCACATTCCGTGGATGGAATCACTTCTCAGGTGCCGAG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1882 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 10 (Ap10) | TGTTTACACATATTCTTGCGCATTACTTGCTTTGGCATTATCTGTATCCCCCTCAGCGG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1889 | 39894103 | 2025 | Introduce a novel, extremely sensitive aptamer against staphylococcal enterotoxin type D | Aptamer 1 | CCTAACCGATATCACACTCAC-GGGTGCAGCCCGGAGCGGCTTGCATGATTGGGTTGGTGGG-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-N40-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin D (SED) | Isolate high-affinity ssDNA aptamers with specificity for SED. | The limit of detection (LOD) for SED was determined to be 45 nM. | 10 | Surface Plasmon Resonance (SPR) and Enzyme-Linked Apta-Sorbent Assay (ELASA) | 4.4 ± 2.26 nM (by SPR) and 13.43 nM (by ELASA) | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1916 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg2 | TGACTGACGACGACTC-TGGAGCTCGGGTATTCTCGTCAGACCCTCCTGAGTTGATTTTAGCAACCG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1917 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg3 | TGACTGACGACGACTC-CGGCGAGTAACGACTATGTCGCACGGGTGTCTTACGAGACGGTTGGGGTC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1918 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg4 | TGACTGACGACGACTC-CTTGTCCATGGCTTGTCCACTCGGGTGTCTGGACAATGAAACCGAACTGC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1919 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8 | TGACTGACGACGACTC-AGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGTACGGGTACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | 183.79 ± 3.27 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1920 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg8A | TGACTGACGACGACTCAGAACGCTTTATGCGCACGGGGGACTTCGGAGTCGTCGAGT | 57 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | Achieving a limit of detection of 10 CFU/mL. | 15 | Fluorescence Binding Assay | 133.15 ± 48.56 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1934 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 7.1 | ACACTAGATCAGTCACAG-GATTAAGGATCGTTGTTGGGTGGTTTCCGTAATTACTATC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1935 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 15.1 | ACACTAGATCAGTCACAG-GGTTGCTCAGGAGAAGGGAACGTGGGTGGTGGCGCGGACG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1936 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 3.1 | ACACTAGATCAGTCACAG-ACGGGGAGAGGGTCATCTCTGGTTTCGGGGTGCTAATTCT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1937 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 8.1 | ACACTAGATCAGTCACAG-CCCCGACCTGTACACGTACTACCCGATGACATTTGGTGTT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1938 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 13.1 | ACACTAGATCAGTCACAG-TGGACGCGGCGGGCCGGATTAAGTTGAGGAGAGGGGGGTG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1939 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 16.1 | ACACTAGATCAGTCACAG-AGTATATATGGATTCCGCAACGTACGCAGGGGGTGTCGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1940 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 14.1 | ACACTAGATCAGTCACAG-CAGAGAGGGGCGGCGAGGGACAAAGGAGGGTAGGTGTGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1941 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 12.1 | ACACTAGATCAGTCACAG-ATCACAGCGGAGGTTTAACGTGTGGCGGGTGTGGGGACATG-GACTTGACTCAGACATCT | 77 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1942 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 11.1 | ACACTAGATCAGTCACAG-GAGCAACAGTCTCGCCTTCGTTACTGCGCGCGGGACGGGG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | CA 11.1 exhibited S. aureus binding in a linear range of 10(3) to 10(8) CFU/mL and a limit of detection (LOD) of 10(3) CFU/mL. | 11 | Bead-based Binding Assay | 263.8 ± 78 nM | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1943 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 17.1 | ACACTAGATCAGTCACAG-AAGTGGAATCAAGCATGGGTATTTTAAGCATCGTATCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1944 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 5.1 | ACACTAGATCAGTCACAG-TGTTTCACGGGGGGGAGGGTAACGGAAGCTAATGGTCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1951 | 10451913 | 1999 | In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection | Aptamer pool | N/A | N/A | N/A | ssDNA | Bacillus Anthracis (BA) | Anthrax spores | Develop an aptamer–magnetic bead-electrochemiluminescence (AM-ECL) sandwich assay for detecting anthrax spores. | Display broad dynamic range equivalent to 10– 6×10(6) anthrax spores. | 4 | ECL-based and Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1952 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-cholera whole toxin aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Vibrio Cholerae | Cholera toxin | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 40 ng in the cholera electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1954 | 16550191 | 2006 | Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by Aptamer-Linked Immobilized Sorbent Assay | Aptamer cocktail | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Francisella Tularensis subspecies (subsp) Japonica | Tularemia Bacterial Antigen | Identify aptamers that bind specifically to the tularemia bacterial antigen from the subspecies japonica or holarctica. | The detection limit for the aptamer cocktail is 25 ng (1.7 × 10^3/ml of bacteria). | 10 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1955 | 17442275 | 2007 | Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis | NK2 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Membrane protein | Identify an aptamer that binds to and improves CD4+T cells & produces IFN-γ by blocking some membrane proteins of H37Rv, decreases the bacterial number, and prolongs the survival rate in the mouse model by inhibiting the invasion of M. tuberculosis into phagocytes and CD8+T cells. | Intracellular IFN-γ levels in CD3+CD4+ T cells increased from approximately 35% (without aptamer) to approximately 55% (with the NK2). The half-life of survival in mice was prolonged by 3 days with a single injection of NK2 aptamer treatment. | 10 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1956 | 17344350 | 2007 | Development and characterization of monoclonal antibodies and aptamers against major antigens of Mycobacterium avium subsp. paratuberculosis | Aptamer 94 | N/A | N/A | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Mycobacterium Avium subsp. paratuberculosis (ATCC 19698) | MAP0105c gene product | Identify aptamers that were screened against the MAP0105c gene product. | Bound specifically to the N-terminal half of MAP0105c, and nearly all mycobacteria tested. | 12 | N/A | N/A | Detection | Counter-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1957 | 19052851 | 2009 | Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detection | C2 and C3 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Surface protein | Identify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection. | Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices. | 5 | N/A | N/A | Biosensor | SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1958 | 20582587 | 2010 | Selection and characterization of DNA aptamers with binding selectivity to Campylobacter jejuni using whole-cell SELEX | ONS-23 | N/A | N/A | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Campylobacter Jejuni (A9a) | Whole cell (bind via proteinaceous nature for cell surface target) | Identify aptamers against C. jejuni and detect them in a mixed cell population. | ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity). | 10 | Flow Cytometry | 292.8 ± 53.1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_1959 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.11 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | CSIR 2.11 achieved 100% sensitivity and 68.75% specificity in detecting antigen in sputum samples. | 6 | Surface Plasmon Resonance (SPR) | 8 ± 1.07 nM | Detection | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1960 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.19 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 1.6 ± 0.5 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1961 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.2 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 21.5 ± 4.3 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1962 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.15 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 12 ± 1.6 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1963 | 23056492 | 2012 | Selection and application of ssDNA aptamers to detect active TB from sputum samples | CSIR 2.21 | N/A | N/A | 5'-GCCTGTTGTGAGCCTCCTAAC-N49-CATGCTTATTCTTGTCTCCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CFP-10 and ESAT-6 monomer and heterodimer | Identify aptamers against the CFP-10.ESAT-6 heterodimer and active TB from human sputum samples. | N/A | 6 | Surface Plasmon Resonance (SPR) | 10.2 ± 3.4 nM | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1964 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK2 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Significantly decreased macrophage invasion from 64.58% (without aptamers) to 33.02% (with 10th aptamer pool), and 26.01% (with NK2). | 10 | Flow Cytometry | 31 ± 4 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1965 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK1 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 48 ± 13 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1966 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK7 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 35 ± 9 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1967 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK8 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 107 ± 44 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1968 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK10 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 95 ± 28 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1969 | 21643749 | 2012 | Aptamer inhibits Mycobacterium tuberculosis (H37Rv) invasion of macrophage | NK20 | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Outer membrane protein (OMP) | Inhibits the H37Rv invasion of macrophages in vitro and activates the infection of macrophages. | Binding affinities are as follows: NK2 > NK7 > NK1 > NK20 > NK10 > NK8. | 10 | Flow Cytometry | 55 ± 16 nM | Therapeutics | Whole Cell-SELEX | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1971 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4936–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 3.1 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1972 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4939–280 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.6 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1973 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4943–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 1.3 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1974 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5564–89 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 9.8 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1975 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5570–54 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin A (TcdA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.6 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1976 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4937–55 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.76 nM | Detection | SELEX | 5-tyrosylaminocarbonyl-dU (TyrdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1977 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4938–17 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.45 nM | Detection | SELEX | 5-benzylaminocarbonyl-dU (BndU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1978 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4940–23 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-naphthylmethylaminocarbonyl-dU (NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1979 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4944–30 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.08 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1980 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5566–74 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.04 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1981 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5573–4 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Toxin B (TcdB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.07 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1982 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 4758–6 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.22 nM | Detection | SELEX | 5-tryptaminocarbonyl-dU (TrpdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1983 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5574–49 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 1.1 nM | Detection | SELEX | 5-phenylethyl-1-aminocarbonyl (PEdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1984 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–11 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 0.05 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1985 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5579–12 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, A chain (CdtA) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | Developed toxin assays show a limit of detection of 1 pmol/L (300 pg/mL) and a 3-log dynamic range. | 8 | Equilibrium Binding Assay | 0.69 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1986 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–51 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 6.9 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1987 | 23680240 | 2013 | Detection of Clostridium difficile toxins A, B and binary toxin with slow off-rate modified aptamers | 5556–67 | N/A | N/A | N/A | ssDNA | Clostridium Difficile | Binary toxin, B chain (CdtB) | Identified slow off-rate modified aptamers (SOMAmer™ reagents) via in vitro selection (SELEX) that bind toxins A, B and binary toxin. | N/A | 8 | Equilibrium Binding Assay | 4.4 nM | Detection | SELEX | 5-(2-naphthylmethyl)aminocarbonyl (2NapdU) and 5′photocleavable biotin, a D-spacer and Cyanine3 (Cy3) Labeled; 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1989 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4503–73 | AZCZGGZZCAAAGZGGCGAZZGGGCAZCZGGZZZZZAAGZ | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·79 nM | Detection | SELEX | Z=BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1990 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4531–56 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Able to bind whole cells of all Staph. aureus strains tested, with a detection limit of approx. 10(4) cells per well (10(5)-10(6) cells/ml). | 8 | Radiolabel Filter Binding Assay | 0·03 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1991 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4522–5 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·35 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1992 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4504–27 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·35 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1993 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4511–67 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 3·90 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1994 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4523–79 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor B (ClfB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·47 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1995 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4726–44 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·38 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1996 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4745–51 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding Protein A (FnbA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1997 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4506–13 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 4·73 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1998 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4516–29 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·63 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1999 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4527–83 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Fibronectin-binding protein B (FnbB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·84 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2000 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4727–62 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·73 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2001 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4746–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·16 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2002 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4728–7 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·14 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2003 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4747–90 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein B (IsdB) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·98 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2004 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4507–52 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·15 nM | Detection | SELEX | BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2005 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4517–71 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·08 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2006 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4528–22 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein C (IsdC) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 0·07 nM | Detection | SELEX | TrpdU (5-tryptaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2007 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4731–69 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Iron-regulated Surface Determinant Protein H (IsdH) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 1·30 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2008 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4730–3 | N/A | N/A | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | SasD | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | N/A | 8 | Radiolabel Filter Binding Assay | 2·17 nM | Detection | SELEX | NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2010 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE24 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE24 aptamer-based ELONA) were 100% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 3.75 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2011 | 24968239 | 2014 | CFP10 and ESAT6 aptamers as effective Mycobacterial antigen diagnostic reagents | CE15 | N/A | N/A | 5'-GCGGAATTCTAATACGACTCACTATAGGGA ACAGTCCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CE (Culture filtrate protein (CFP10) and Early secreted antigenic target (ESAT6)) proteins | Identify aptamers against CE proteins and develop an aptamer-based ELONA assay for detection in serum samples. | Sensitivity and specificity using CE15 aptamer-based ELONA) were 89.6% and 94.1%. | 15 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.6 × 10(−7) M | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2012 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-27 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2013 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-33 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-33 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2014 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-36 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-36 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2015 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-49 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2016 | 25511112 | 2015 | Development of a fluorescent enzyme-linked DNA aptamer-magnetic bead sandwich assay and portable fluorometer for sensitive and rapid listeria detection | LLO-3 | N/A | N/A | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | A fluorescent DNA aptamer-magnetic bead sandwich assay was developed to detect LLO protein. | Demonstrated LODs in the range of 4 to 61 L. monocytogenes cells or the equivalent LLO produced by 4 to 61 cells on average in a separate titration trial. | 8 | Enzyme-Linked Immunosorbent Assay (ELISA)-like Aptamer Microplate Affinity Ranking (ELASA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent filled |
| ABdb_2017 | 27151293 | 2016 | Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity | H19 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-45N-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Streptococcus Mutans | Whole cell | Identify a high-affinity aptamer against cariogenic S. mutans strains. | Aptamer H19 showed strong binding, as indicated by higher fluorescence intensity, with Strains 12 and 17 compared with other strains. | 9 | Flow Cytometry | 69.45 ± 38.53 nM | Detection | Subtractive SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2018 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T9 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | Specificity and sensitivity were 95.31% and 83.00% (for 100 aPTB serum samples), 98.70% and 92.71% (for 96 aPTB sputum samples), and 94.44% and 88.71% (for 62 EPTB serum samples), respectively. | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 668 ± 159 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2019 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T25 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 685 ± 131 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2020 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T14 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 815 ± 144 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2021 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T15 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 736 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2022 | 26850356 | 2016 | Generation and application of ssDNA aptamers against glycolipid antigen ManLAM of Mycobacterium tuberculosis for TB diagnosis | T6 | N/A | N/A | 5'-GCGGAATTCAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) Beijing genotype strains | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify an aptamer against ManLAM and develop an ELONA-based assay for the diagnosis of TB antigens using serum or sputum samples. | N/A | 13 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 998 ± 207 nM | Detection | SELEX | Biotinylated or FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2109 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA10 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 28 ± 4 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2110 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA7 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | EA7 binds to the lipid A region of LPS and exhibits a detection limit of 3 ng/mL and a linear range of 5–250 ng/mL. | 15 | Fluorescence Binding Assay | 102 ± 17 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2111 | https://doi.org/10.1007/s00604-017-2453-3 | 2017 | Orientation selection of broad-spectrum aptamers against lipopolysaccharides based on capture-SELEX by using magnetic nanoparticles | EA5 | N/A | N/A | 5'-ATAGGAGTCACGACGACCAG-40N-TATGTGCGTCTACCTCTTGA-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50671) | Lipopolysaccharide (LPS) lipid A domain | Identify aptamers that bind to the LPS target. | N/A | 15 | Fluorescence Binding Assay | 149 ± 30 nM | Detection | Orientation selection based on Capture-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2112 | 28728009 | 2017 | Bridged Rebar Graphene functionalized aptasensor for pathogenic E. coli O78:K80:H11 detection | Anti-E.coli aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O78:K80:H11 (MTCC 726) | Whole cell | A novel fabrication method of functionalised Bridged Rebar Graphene (BRG) onto EIS-based nanostructured aptasensor for label-free detection of E. coli O78:K80:H11. | LOD ~ 10(1) cfu/mL with a dynamic response range from 10(1) to 10(6) cfu/mL. | 12 | Bio-Layer Interferometry (BLI) | 14 nM | Biosensor | Phenylboronic acid (PBA) mediated SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2113 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA05 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2114 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA08 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2115 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH05 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2116 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH08 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2119 | 30245324 | 2018 | Aptamer functionalized MoS2-rGO nanocomposite based biosensor for the detection of Vi antigen | Anti-Vi aptamers population | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Salmonella Typhi | Vi polysaccharide antigen (Vi antigen) | Developed a novel aptamer functionalized MoS2-rGO-based electrochemical aptasensor for Vi polysaccharide antigen-mediated detection of enteric fever. | Responded linearly in the range between 0.1 ng/mL to 1000 ng/mL with a detection limit of 100 pg/mL. | 6 | Saturation Binding Assay | 638.6 nM | Biosensor | SELEX | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2124 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-1 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) are used to develop a triple-module biosensor to capture H. pylori. | Exhibited a wide detection range of 10-10(7) CFU/mL and a limit of detection (LOD) as low as 1 CFU/mL. | 10 | Fluorescence Spectroscopy | 36.91 ± 11.1 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2125 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-2 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 46.31 ± 11.31 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2126 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-3 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 60.76 ± 11.69 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2127 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-4 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 41.57 ± 16.18 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2128 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-5 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 67.74 ± 10.24 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |