Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 3
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1789 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP1 | GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1790 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP2 | CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG | 48 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent Application No. 202241038353 |
| ABdb_1791 | 37591900 | 2023 | Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples | LAP3 | TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC | 45 | 5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3' | ssDNA | Leptospira Interrogans | Outer membrane protein (OMP) | Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection. | Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL. | 10 | Fluorescence Spectroscopy | 133.13 ± 22 nM | Biosensor | Modified Microtiter Plate-based Cell SELEX | 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | Patent Application No. 202241038353 |