Method : Microtiter Plate-based Cell SELEX

Total records found: 4

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1404	32685985	2020	Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7	Anti-E. coli O157:H7 aptamer	ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT	81	5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3'	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform.	Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples.	15	Bio-Layer Interferometry (BLI)	69.73 nM	Biosensor	Microtiter Plate-based Cell SELEX	5'-Biotinylated and 5'-FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1789	37591900	2023	Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples	LAP1	GGGCGTTAAAGATACAGGAACCGGTGTCGAGGTCTGAAGAATCCT	45	5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'	ssDNA	Leptospira Interrogans	Outer membrane protein (OMP)	Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.	N/A	10	Fluorescence Spectroscopy	N/A	Biosensor	Modified Microtiter Plate-based Cell SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	Patent Application No. 202241038353
ABdb_1790	37591900	2023	Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples	LAP2	CGTACGTCTGTCTCTGCATCTTATTGCTATGGAATAATGTTGTTCTGG	48	5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'	ssDNA	Leptospira Interrogans	Outer membrane protein (OMP)	Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.	N/A	10	Fluorescence Spectroscopy	N/A	Biosensor	Modified Microtiter Plate-based Cell SELEX	5'-FITC Labeled	N/A	N/A	N/A	N/A	Patent Application No. 202241038353
ABdb_1791	37591900	2023	Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples	LAP3	TGGCGTTAGAGATACCGGAACCGGTGTCGGGCGTCTGAAGAATCC	45	5'-GAGTATCCAGACGCAGCA-N45-TGGACAGGCTTAGTCGGT-3'	ssDNA	Leptospira Interrogans	Outer membrane protein (OMP)	Development of an aptamer-gold nanoparticle-based colorimetric assay for pathogenic Leptospira detection.	Exhibited a detection limit of 57 CFU/mL and a linear response in the concentration range of 6 × 10(5) to 60 CFU/mL.	10	Fluorescence Spectroscopy	133.13 ± 22 nM	Biosensor	Modified Microtiter Plate-based Cell SELEX	5'-FITC Labeled	N/A	N/A	Best Candidate	N/A	Patent Application No. 202241038353