Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 40
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0080 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 4R | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | Detect as few as 30 live, unlabeled E. coli per ml using FRET assay. | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0081 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 3R | ATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0082 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 8F | ATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT | 72 | 5'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0134 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6F | ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0135 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6R | ATCCGTCACACCTGCTCT-GCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGGA-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_1349 | 31953175 | 2020 | Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | SipA protein | Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion. | 70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively. | 9 | Fluorescence Spectroscopy | 114.9 nM (at 27°C) and 63.4nM (at 37°C) | Therapeutics | Magnetic Bead (MB)-based SELEX | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1873 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 3 (Ap3) | NNNNNNNNNNNNNNNNNNNNNGGGGGCTTTCAAGGGCGCGACGAAGCTGTTTTATTCTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | Achieved a detection limit of 0.1 ag/mL EC proteins (equivalent to 3 protein particles per mL) within 120 min from the plasma sample. | 15 | Isothermal Titration Calorimetry (ITC) | 8.30 x 10-7 M | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1874 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 1 (Ap1) | GACGTTTTGCAAGTGCGGCTACTACAAGCGAAGTTCCATCATTTTAGAGTCATAAACGC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1875 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 6 (Ap6) | CCGCCTGGAAGGCATTTCGCCGGGAAGACCCACGTCACTCCTCCCCTGAACTTCGGTTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1876 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 2 (Ap2) | TATACATTGATTTATCGGACCACTGCAGTACCACGCAGGATGGACGGCCATCGTTAATA | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1877 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 4 (Ap4) | TAGGATTCGTTTATTCGTGGGGCTGTAGTTCCGATAAAACCGCCAAGGGATCGTTGCCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1878 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 5 (Ap5) | ATTAGATGTAAAACGCCACGGGTAGCAGTTAAAGTCGTATTTATAGGCACAACGAAGAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1879 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 7 (Ap7) | CAATTAGACAGGCTCTAAGCTTTGGACCCAGCGTAGAAAGTTTGTTATTTCTTCGGGCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1880 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 8 (Ap8) | ATAAGCTTTTTAAGGCAAGGACGCGGCCCGGTACTTGCGTTGGAGGAATCTTAAGTTAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1881 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 9 (Ap9) | CATTTATAACTACGATTGTGGTCACATTCCGTGGATGGAATCACTTCTCAGGTGCCGAG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1882 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 10 (Ap10) | TGTTTACACATATTCTTGCGCATTACTTGCTTTGGCATTATCTGTATCCCCCTCAGCGG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1952 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-cholera whole toxin aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Vibrio Cholerae | Cholera toxin | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 40 ng in the cholera electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2016 | 25511112 | 2015 | Development of a fluorescent enzyme-linked DNA aptamer-magnetic bead sandwich assay and portable fluorometer for sensitive and rapid listeria detection | LLO-3 | N/A | N/A | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | A fluorescent DNA aptamer-magnetic bead sandwich assay was developed to detect LLO protein. | Demonstrated LODs in the range of 4 to 61 L. monocytogenes cells or the equivalent LLO produced by 4 to 61 cells on average in a separate titration trial. | 8 | Enzyme-Linked Immunosorbent Assay (ELISA)-like Aptamer Microplate Affinity Ranking (ELASA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent filled |