Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 447
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0015 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.4 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UCACUGUUAUCCGAUAGCAGCGCGGGAUGA-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | 2.0 μg of RNA aptamer S-PS8.4 effected ca. 71% inhibition of cell invasion by pil+ S. enterica serovar Typhi A21-6 but only ca. 19% inhibition in the case of the pilS::Kmr mutant. | 8 | Nitrocellulose Filter Binding Assay | 8.56 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0016 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.3 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AUUACCUAGAGCGGGAUAAAGUAUAGGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0017 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.2 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-CAUCGAGGAGGCGGGAUAUUCGAUGAGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0018 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.5 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAGUACGAGCGGGAUAGUAAUCGGGUGAU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0019 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.6 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAAGGGGUCCGGCUCGGGUGAGGGUCGGGU-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0020 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.9 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AGCUAGCGGGGGGGCUCGACGGUGGUGGGUU-GGGUCAAUGCGUCAUA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0021 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.7 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UAGCGGGAGCUUGGACCUGGUGGUCGCGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0022 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.1 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UUGGGAUCAGCUCGGCGCUGGAGGAGGGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0023 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.8 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AACUGUACAUGGGCGCAACAGGGAGUUAGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0024 | 17188871 | 2007 | In vitro selection of RNA aptamer against Escherichia coli release factor 1 | Class II-1 | GGACCGAGAAGUUACCCUGUAAUCUUAGGAUGAAUCGCAUGCUCUAGCGACCUUUUCGGCUUCGGCGUACGCACAUCGCAGCAAC | 85 | N/A | ssRNA | Escherichia Coli (E. Coli) | Release factor 1 (RF-1) | Identify aptamers that bind to and inhibit the action of RF-1 to enhance the efficiency of nonsense suppression. | Aptamer class II-1 (12 μM) increased the suppression efficiency (44% → 89%). | 11 | Surface Plasmon Resonance (SPR) | 30 ± 6 nM | Therapeutics | SELEX | 3'-Biotinylated (Biotin-d(A)11) or 3'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0047 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3P | AGCAGCACAGAGGTCAGATG-TCGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG-CCTATGCGTGCTACCGTGAA | 81 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0048 | 18214875 | 2008 | Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli. | The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min. | N/A | N/A | N/A | Detection | SELEX | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0049 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Identify aptamers that bind to S. aureus strains, including 8325-4, 196, and 04018, and develop a probe to distinguish them from S. epidermidis, Streptococcus, and E. coli. | EC50 = 70.86 ± 39.22nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0050 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 61.50 ± 22.43nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0051 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50=82.86 ± 33.20nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0052 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 =72.42 ± 35.23nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0053 | 19498077 | 2009 | Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus | SA43 | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Recognition of different S. aureus strains and mixed aptamer probes distinguishes S. aureus strains, including 8325-4, 196 and 04018, from S. epidermidis, Streptococcus and E. coli. | EC50 = 210.70 ± 135.91nM and with Multiple aptamers: 479.98 ± 209.94nM. | 5 | Flow Cytometry | N/A | Detection | Subtractive SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0059 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 19 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment. | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0060 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 18 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0061 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 31 | TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG | 81 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0062 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 14 | TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG | 82 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0064 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 43 | TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG | 83 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0073 | 19505816 | 2009 | A sensitive method to detect Escherichia coli based on immunomagnetic separation and real-time PCR amplification of aptamers | E. coli specific RNA aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop an aptamer-based, antibody-conjugated magnetic-bead sandwich assay to detect E. coli. | Showed a wide dynamic range from 10¹ to 10(7) E. coli per ml and achieved a detection limit of 10 E. coli in a 1 ml sample. | N/A | N/A | N/A | Biosensor | N/A | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0079 | 20961052 | 2010 | Real-time potentiometric detection of bacteria in complex samples | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) CECT 675 cells | Whole cell | Potentiometric aptamer-based biosensor to detect E. coli CECT 675 as a nonpathogenic surrogate for pathogenic E. coli O157:H7 in complex liquid samples. | Display LOD of 10(4) CFU/mL with a linear range from 4 to ∼10(4) CFU/mL. The lowest bacterial count detected in complex matrices was 12 CFU in 2 mL of milk (6 CFU/mL) and 26 CFU in 1 mL of apple juice. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation ((CH2)5-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0123 | 21875107 | 2011 | Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction | Sal aptamer | CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC | 86 | 5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples. | Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0124 | 22310030 | 2012 | Development of RNA aptamers for detection of Salmonella Enteritidis | S25 | GGGUUCACUGCAGACUUGACGAAGCUU-GAGAGAUGCCCCCUGAUGTGCAUUCUUGUUGUGUUGCGGC-AAUGGAUCCACAUCTACGAAUUC | 90 | 5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3' | ssRNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer that binds to the outer membrane protein C and specifically recognizes S. enteritidis without any cross-reactivity to other Salmonella serovars. | Fluorescence intensity of S. Enteritidis enhanced as the concentration of the aptamer S25 increased from 5 to 30 μg. | 10 | Flow Cytometry | N/A | Detection | Magnetic Bead (MB)-based SELEX | 5'-Fluoro-labeled with Fluorescein-maleimide | N/A | N/A | N/A | N/A | N/A |
| ABdb_0125 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3P | ATAGGAGTCACGACGACCAGAA-TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | Showed a high binding affinity of 76% for V. parahemolyticus and a low apparent binding affinity of 4% for other bacteria. | 9 | Flow Cytometry | 16.88 ± 1.92 | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0127 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1P | ATAGGAGTCACGACGACCAGAA-TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1P was 67%. | 9 | Flow Cytometry | 21.45 ± 2.62 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0129 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A17P | ATAGGAGTCACGACGACCAGAA-AGGCCGGCCCCTCTGAACTAGATGCAGGGGAGGCGAGCGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0130 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A18P | ATAGGAGTCACGACGACCAGAA-GCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A18P was 62%. | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0131 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A21P | ATAGGAGTCACGACGACCAGAA-TTTTGACGAAGTCAGTGCGTCGAAGCGCAAGCATTACAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | N/A | 9 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0147 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B1 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | Achieved a linear detection range of 0.01 to 1 ng/mL of LPS with a detection time of less than 15 minutes. | 3 | Surface Plasmon Resonance (SPR) | 20 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0148 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B2 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 12 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0149 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B3 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGTTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 32 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0150 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B4 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 21 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0151 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B5 | CTTCTGCCCGCCTCCTTCC-CTAAGCACAGGGAAACCAGCTAATGAGTTAGGCCTGTCCCCCACG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 484 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0152 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B6 | CTTCTGCCCGCCTCCTTCC-CAATGGACCTATTCGAGTACTGAATAGAACAGTCGGCGCTCTGGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 298 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0153 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B7 | CTTCTGCCCGCCTCCTTCC-TTCAAGACGATGCCTGGCGCGAGTTACACACTTGCATGGAGCTGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 61 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0154 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B8 | CTTCTGCCCGCCTCCTTCC-ATCCAATACCTCAGAACTCAGTTCGAGTCGTAAAGGGGAATCGCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 71 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0155 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B9 | CTTCTGCCCGCCTCCTTCC-ACCGATCCATCGAGTTTCTGAGAAAGGCCCGGAGAAACCGCGAGA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 15 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0156 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B10 | CTTCTGCCCGCCTCCTTCC-TCAATCTAACCATGCATGCAGTTTAGGCAGGATTCGTTATCGCAA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 2336 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0214 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2P | ATAGGAGTCACGACGACCAGAA-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | The limit of detection (LOD) was 25 cfu/mL, and the percentage gated fluorescence intensity above library background was 20% when ST9P was incubated with L. monocytogenes cells and 72% when incubated with S. typhimurium. | 9 | Flow Cytometry | 6.33 ± 0.58 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0216 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST3P | ATAGGAGTCACGACGACCAGAA-TTTCGGCTAAGGACGGGTGAAATACATTTAATAGGGTGGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0217 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST7P | ATAGGAGTCACGACGACCAGAA-TAAGTACAGGACTGGAGTATTAGCGGGGTCCATGCAAGGC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | N/A | 9 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0219 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9P | ATAGGAGTCACGACGACCAGAA-AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 66 ± 1.45% for ST9P. | 9 | Flow Cytometry | 11.14 ± 0.12 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0229 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA1/SA-1 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GCGTGCGGGGGCCAGGATGCGA-GGTGGATCCATATTCCTACTCG | 82 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0230 | 23978634 | 2013 | Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis | CA2/SA-2 | CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-GGTCTGTAGGTCTGCGGCGCGCG-GGTGGATCCATATTCCTACTCG | 83 | 5'-CGGATGCGAATTCCCTAATACGACTCACTATAGGGCGT-N40-GGTGGATCCATATTCCTACTCG-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that detect and specifically bind to the surface of S. Typhimurium. | N/A | 10 | Fluorescence Spectroscopy | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0233 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt10 | GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 83 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 73 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0275 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #2 | GGGAGAGCGGAAGCGUGCUGGGCC-GGGAGUUUUGAUACGGCUUCAUGCAGUAAUGUUUUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | The level of binding of #2 RNA aptamer to S. aureus was 1.6-fold higher than that of the control aptamer. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0276 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #10 | GGGAGAGCGGAAGCGUGCUGGGCC-GUUAAUACGGUGUCUUUUUCGGUCGUGUAUAAAACGGAAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0277 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #14 | GGGAGAGCGGAAGCGUGCUGGGCC-UAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0278 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #16 | GGGAGAGCGGAAGCGUGCUGGGCC-UUAGAAGUAGCCUGCUACGCAUGGUCGACUCAAGAAUCG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0279 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #18 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0280 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #21 | GGGAGAGCGGAAGCGUGCUGGGCC-AGUCUGACACGUAGACAGUUCUAUUACUUACGUCGAGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 88 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0281 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #23 | GGGAGAGCGGAAGCGUGCUGGGCC-ACAGUGUUCUAAUGCGACAAUGGAGUCUGUGGCAAAGUGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0282 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #24 | GGGAGAGCGGAAGCGUGCUGGGCC-UCUCAGGCCGACAUUCUGAGAACGCGAGGCGUAUUGAAG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0283 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #26 | GGGAGAGCGGAAGCGUGCUGGGCC-UUCAAGUAGGGGCGGUUUACUAUCUGGAUCUUGUAGUUAU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0284 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #07 | GGGAGAGCGGAAGCGUGCUGGGCC-ACUUGGGGACGACGAGUAGAUAGUAAGGUGGAGACCUGGU-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0285 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #06 | GGGAGAGCGGAAGCGUGCUGGGCC-UAUGACAUAAGGUGGGCUGGGAAGCUAGAGCAUGUAAGG-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0286 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #05 | GGGAGAGCGGAAGCGUGCUGGGCC-GUGAAGAAAAAGGGGCGGAUUGGGUAGUAGGGAGGAGAUC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0287 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone #04 | GGGAGAGCGGAAGCGUGCUGGGCC-AGGAUAGGGGAUGAAGAAAAAAAGAAGGGUGCCGUGGCGC-CAUAACCCAGAGGUCGAUGGAUCCCC | 90 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0288 | https://doi.org/10.1007/s13213-013-0720-z | 2013 | In vitro selection of RNA aptamer specific to Staphylococcus aureus | Clone G1 | GGGAGAGCGGAAGCGUGCUGGGCC-UCCGAACAGCGGAAGGUGGUUCGAAGUUGGGGCUUUGGA-CAUAACCCAGAGGUCGAUGGAUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Staphylococcus aureus (S. aureus) | Teichoic acid | Identify aptamers that bind to cell surface-exposed epitopes of the teichoic acid. | N/A | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0317 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E1 | GCAATGGTACGGTACTTCC-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 12.4 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0318 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E2 | GCAATGGTACGGTACTTCC-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 25.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0319 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E10 | GCAATGGTACGGTACTTCC-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-CAAAAGTGCACGCTACTTTGCTAA | 90 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 14.2 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0320 | 23357235 | 2013 | Isolation and characterization of DNA aptamers against Escherichia coli using a bacterial cell-systematic evolution of ligands by exponential enrichment approach | E12 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolated and characterized aptamers against Escherichia coli. | Display binding ranging from 42.6% to 131.8% to E. coli. | 10 | Fluorescence Spectroscopy | 16.8 nM | Detection | Whole Cell-SELEX | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0322 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S 1 | ATAGGAGTCACGACGACCAGAA-CGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Identify an aptamer targeted against Shigella dysenteriae and develop a sandwich-type fluorescent bioassay for quantification. | Obtained linear range between 10(2)-10(7) cfu/mL of S. dysenteriae, and the limit of detection was 50 cfu/mL | 8 | Fluorescence Binding Assay | 23.47 ± 2.48 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled and Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0323 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S12 | ATAGGAGTCACGACGACCAGAA-CCTGGCGGGTCCCGGGGTAAACGGCACAAACGATAAAGAA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0324 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S2 | ATAGGAGTCACGACGACCAGAA-AAGATGACACTTGGCAGCCGCCTCGAGTGTCCTACACGCA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0325 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S8 | ATAGGAGTCACGACGACCAGAA-GCCAGATGAGGCCGGCAGGGCCCAAGTGTTGCTCGGGCTA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0326 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S21 | ATAGGAGTCACGACGACCAGAA-TGCACGGGACAAGAGTACACGCCGATTGCCAGGCACAGTG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | 75.49 ± 3.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0327 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S10 | ATAGGAGTCACGACGACCAGAA-GGGGAAGCCGATCAGGCCAATCATTGAGGGTGAACTAGCT-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0328 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S19 | ATAGGAGTCACGACGACCAGAA-TTATCGGCTGGCAAAACTGCGGCTGGAGCTCACAACTAGA-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0329 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S13 | ATAGGAGTCACGACGACCAGAA-TCAGCGAGGGCCAATTAGAAGGGTACTCATGTCTGTGGAC-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0330 | 23811206 | 2013 | In vitro selection of a DNA aptamer targeted against Shigella dysenteriae | S24 | ATAGGAGTCACGACGACCAGAA-CCAGGCGGAATGTGTCTTCGTTTTGCGAGTGTTAAGGGCG-TATGTGCGTCTACCTCTTGACTAAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Shigella Dysenteriae | Whole cell | Aptamer S 1 binds to S. dysenteriae with high affinity and specificity. The binding is subsequently used in a sandwich-type fluorescent bioassay for quantification | N/A | 8 | Fluorescence Binding Assay | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0334 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A2 | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) (CECT 675) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 4 to 10(4) CFU/mL and LOD of 4 CFU/mL, and the signal was stable after 120 s. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0335 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A3 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 8 × 10(2) CFU/mL–10(8) CFU/mL with LOD of 8 x10(2) CFU/mL and the signal was stable for at least one hour. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0339 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. aureus (FASA) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL. | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0343 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | ZXL1 bound to virulent M. tb H37Rv much more strongly (52.2%) than to the other Mycobacteria strains tested, M. smegmatis (2.5%) and BCG (13.9%). LPS-stimulated human DC groups showed that ZXL1 decreased IL-10 production by 31–36% and increased IL-12 production by 52–91%, thereby reducing the progression of infection and bacterial loads in mice and rhesus monkeys. | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 436.3 ± 37.84 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated or FAM Labeled | ZXL1 showed no significant cytotoxicity at concentrations ranging from 2 to 15 microM at the 168-hour test. | N/A | Best Candidate | N/A | N/A |
| ABdb_0344 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-AGTCCACGATAATCACACACACGGACACCC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0345 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CACGCCCAATAGTGGCTCCAGCTCATCTCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0346 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL5 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CATCGATGTACCCTACCTACATGTTACGTT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0347 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL6 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-ACCTACAGCGACACCTAACTGAGTAGAACT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0348 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL7 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TACCTAACACTTCCTGCTCCACCTTTATTA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0349 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL8 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCTGATTCCCCCTCATCCGATGGACATCT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0350 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL9 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GACCCTCATGATACCAACCACTCCAGTCAA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0351 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL10 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TATCCCAGTGGCATTAACTACCCACTCGCA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0352 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL3 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCACGGAGTGAGGGGCTGTTCATTAAGAGA-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0353 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL12 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGCCTGATAGGTCTGTGATCCAATCCAAT-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0354 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL13 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCTGCTTGCCGCTGATCCGCCAATTCGATC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0355 | 24572295 | 2014 | Aptamer against mannose-capped lipoarabinomannan inhibits virulent Mycobacterium tuberculosis infection in mice and rhesus monkeys | ZXL14 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-TCGTGCCGACGCTGCCGAATAGCACTGCAC-GGGTCAATGCGTCATA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identify aptamers that bind to and inhibit ManLAM recognition by host cells and ManLAM-induced immunosuppression of CD11c+ dendritic cells (DCs). | N/A | 12 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0414 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA20 | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0415 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0416 | 24804556 | 2014 | Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop aptamer recognition and FSiNPs label-based dual-colour flow cytometry assay (Aptamer/FSiNPs-DCFCM) for the detection of S. aureus. | Detects as low as 1.5×10(2) and 7.6×10(2) cells/mL S. aureus in buffer and spiked milk, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0427 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 12.4 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0428 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 25.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0429 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 14.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0430 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₁ | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0431 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₂ | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0432 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₃ | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0435 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-2 | AGTATACGTATTACCTGCAGC-TGGGGGGTGGTTGGGGGTAGTATATCGGGTCAGTGGTGCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0436 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-103 | AGTATACGTATTACCTGCAGC-GGGAGGCGTGAAGTGTGATGGTGTGGGGGGTAGTGGCCGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0437 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-109 | AGTATACGTATTACCTGCAGC-CCGCTCAACAAGGTGCTACAAAGATCCTGTGTCCCTTGGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0438 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-116 | AGTATACGTATTACCTGCAGC-TACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | LM6-116 showed strong genus-specific binding affinity when screened against five different species within the Listeria genus. | 6 | Flow Cytometry | 74.4 ±52.69 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0439 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-118 | AGTATACGTATTACCTGCAGC-CTGGTATAGACGTTATTCGTCCGCTCTTGTATCCTTGTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0440 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM6-121 | AGTATACGTATTACCTGCAGC-TGTCGGTGGGGGGTGGCTTGAGTACGTGACGTGGTGTGGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0441 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-2 | AGTATACGTATTACCTGCAGC-CCATTGTTCTATCGCTAGCTCGCTCTGGCCAGCTCCTTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0442 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-6 | AGTATACGTATTACCTGCAGC-TCTGTGTTCCGTTTTCGATTCTTACTGTGTTTTCGGGTGC-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | 106.4 ±43.91 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0443 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-13 | AGTATACGTATTACCTGCAGC-TGGGGGGGGGGGGAGGGGTCGGTGAGCGTGGGAGGAGGAG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0444 | 24857773 | 2014 | Selection and characterization of DNA aptamers specific for Listeria species | LM12-74 | AGTATACGTATTACCTGCAGC-CCGACCTTCTATCCTTCCAGTTTTTTGTAAACTCTTCTGG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify an aptamer against Listeria spp. at different growth phases. | N/A | 6 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0457 | 24913871 | 2014 | A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology. | Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0461 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt1 ( V. parahaemolyticus aptamer) | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0462 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt2 (S. typhimurium aptamer) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 14028) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 35 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0466 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0467 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Amplify-aptamer (a-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0497 | https://doi.org/10.1016/S2095-3119(14)60766-8 | 2014 | In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes | g04 | TGGGAGCTCAGAATAAACGCTCAA-GGGGGGGGGGTATTGGCAGAGGTGGTTAGGTGGCCCTT-CGACATGAGGCCCGGATCA | 81 | 5'-GGGAGCTCAGAATAAACGCTCAA-35N-CGACATGAGGCCCGGATC-3' | ssDNA | Listeria Monocytogenes | Whole cell | Identify aptamers and developed a fluorescently-labeled aptamer assay for detecting L. monocytogenes. | N/A | 9 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0586 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-1 | CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0587 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-2 | CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0588 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-3 | CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0589 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-4 | CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0590 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-5 | CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0591 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-6 | CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0592 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-7 | CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0593 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-8 | CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0594 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-1 | CGGATCCATGGGCACTATTTATATCAA-CCCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0595 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-2 | CGGATCCATGGGCACTATTTATATCAA-GGCTAGGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0596 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-3 | CGGATCCATGGGCACTATTTATATCAA-CCTTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0597 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-4 | CGGATCCATGGGCACTATTTATATCAA-GGCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0598 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-5 | CGGATCCATGGGCACTATTTATATCAA-CTGCACGTGGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0599 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-6 | CGGATCCATGGGCACTATTTATATCAA-GACTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0600 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-7 | CGGATCCATGGGCACTATTTATATCAA-GCCATTCGTCACTGAGTTGCTCTAGTGCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0601 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-8 | CGGATCCATGGGCACTATTTATATCAA-CTAAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0602 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-1 | CGGATCCATGGGCACTATTTATATCAA-GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0603 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-2 | CGGATCCATGGGCACTATTTATATCAA-GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0604 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-3 | CGGATCCATGGGCACTATTTATATCAA-TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0605 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-4 | CGGATCCATGGGCACTATTTATATCAA-TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0606 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-5 | CGGATCCATGGGCACTATTTATATCAA-CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0607 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-6 | CGGATCCATGGGCACTATTTATATCAA-CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0608 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-7 | CGGATCCATGGGCACTATTTATATCAA-GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0609 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-1 | CGGATCCATGGGCACTATTTATATCAA-CCTCACATAGTGACGATGTGGTTTGGTACCTCTATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0610 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-2 | CGGATCCATGGGCACTATTTATATCAA-CCGTGGATGTACGAAATTAACCGCACACCTAGCTACCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0611 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-3 | CGGATCCATGGGCACTATTTATATCAA-CGCATGCTTCTCGGGATACGGGCGGCTCGATAGAGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0612 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-4 | CGGATCCATGGGCACTATTTATATCAA-GCTTACTACGTTTGCCTCAGTGTGTTCCGGTCTTAACAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0613 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-5 | CGGATCCATGGGCACTATTTATATCAA-CCCATACCTTTTTCGATAGTAAGTGCCATGCCCATCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0614 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-6 | CGGATCCATGGGCACTATTTATATCAA-GCCTAGAACCCCCTGTCTAGTCAAGTAGTGCGAGTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0615 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-7 | CGGATCCATGGGCACTATTTATATCAA-GCCTTACCGCTCTATCACTCGTCTGTTGCCACTCAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0616 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-8 | CGGATCCATGGGCACTATTTATATCAA-TGCGCCGATAGTTTCGATCATGATGCATCTGGCTGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0617 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-9 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0618 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-1 | CGGATCCATGGGCACTATTTATATCAA-TTGCTACAGGTATTGCACAACCTCGTGTGGTGTCCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0619 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-2 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0620 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-3 | CGGATCCATGGGCACTATTTATATCAA-GCTGGCAACTGGATGCACTCGTCCTCAGCCTCGGTCAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0621 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-4 | CGGATCCATGGGCACTATTTATATCAA-GCCCGTGAGACTATACCCTATGCACTAGTTGCGTAATAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0622 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-5 | CGGATCCATGGGCACTATTTATATCAA-GCTCGCGTCTGAGGGAAGTTACGTTATTTCGCTTGTAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0623 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-6 | CGGATCCATGGGCACTATTTATATCAA-CCGGACTTTAAGCGGCTTCTCGTGGCTGGGTAATCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0624 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-7 | CGGATCCATGGGCACTATTTATATCAA-CCTGACCGATGTTGTATTAATGGCTCCGGGTCTTATGAG-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0625 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-8 | CGGATCCATGGGCACTATTTATATCAA-CGAGGGGTTGGTTTGTGGTGTTGCCGCCACTACAGCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0699 | 25461175 | 2015 | A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed an aptamer/graphene interdigitated gold electrode piezoelectric sensor to detect Staphylococcus aureus. | Achieved a detection limit of 41 cfu/mL with a linear range of 4.1×10(1) to 4.1×10(5) cfu/mL. The detection is rapid, completing in less than 60 minutes. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0701 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 35 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0703 | https://doi.org/10.1080/00032719.2015.1036278 | 2015 | Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop an aptamer-based magnetoelastic sensor for the detection of S. aureus. | Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0710 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #8 | TCAGTCGCTTCGCCGTCTCCTTC-AGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 82 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #8 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 12.82 ± 6.00 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0746 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B5 | CAGTCCAGGACAGATTCGCGAG-CCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | LOD was 7.9 × 10(3) CFU/mL and a linear range from 7.9 × 10(2) to 7.9 × 10(6) CFU/mL of S. typhimurium with less than 1 h. | 10 | Quartz Crystal Microbalance (QCM) | 58.5 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0747 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A24 | CAGTCCAGGACAGATTCGCGAG-GCACAATCCACCTCTCACCGCACGCCACGCACTGCCTCTGTCCCG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 19.63 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0748 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B30 | AATCGCTGAATGAAATCCACGTG-GGAAGTGTGTGGGTGACCAGAGGTGTGGTGATGGGATTGTCGTA-CCTCGCGAATCTGTCCTGGACTG | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | 51.02 nM | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0749 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B31 | CAGTCCAGGACAGATTCGCGAG-CCGCACCGCCCTATCCTCGTGTCCCTGCCCAACAGCGCCGCCCGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0750 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | A37 | CAGTCCAGGACAGATTCGCGAG-GTGGGGCGGGAAAGTGTGTGTAGGTGGTGGCGTTGTCACGGCGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0751 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B16 | CAGTCCAGGACAGATTCGCGAG-GGGCTGTGTGAGAAGTGGGTGTGGTGGTGGATATGCAACGTTGTA-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0752 | 27979272 | 2016 | QCM-based aptamer selection and detection of Salmonella typhimurium | B21 | CAGTCCAGGACAGATTCGCGAG-GTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-45N-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers that bind to and detect S. typhimurium using a QCM-based aptasensor. | N/A | 10 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | QCM-based SELEX | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0753 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM2 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CCCCATGAACTAGGCTCCACAATGAGTTTGG-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | Ki of BM2 was estimated to be 10.34 ± 0.27 nM, with a LOD of 1 × 10^4 cfu/100 μL of BCG. | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | 8.59 ± 1.23 nM | Therapeutics/Immunmodulatory | SELEX | Biotinylated | BM2 was demonstrated to be safe with low toxicity based on in vitro and in vivo toxicity analyses. | BM2–BCG complex could be detected and remained stable for at least 30 days in vivo. | N/A | N/A | N/A |
| ABdb_0754 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGGTCGTAGACCGGGAGTTGTTGTTAGTTCA-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0755 | 27529508 | 2016 | A Single ssDNA Aptamer Binding to Mannose-Capped Lipoarabinomannan of Bacillus Calmette-Guérin Enhances Immunoprotective Effect against Tuberculosis | BM4 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-CGCGCAGCGGGTCGACTTCATTCCTCACCAT-GGGTCAATGCGTCATA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N31-GGGTCAATGCGTCATA-3' | ssDNA | Mycobacterium Bovis (bacillus Calmette–Guérin (BCG)) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Identified aptamers against ManLAM and served as an immune enhancer for BCG against M. tb H37Rv infection via blocking MR binding, triggering ManLAM–CD44 signalling, and enhancing M1 macrophage and Th1 activation via cellular surface CD44 in vitro and in vivo. | N/A | 10 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Therapeutics/Immunmodulatory | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0761 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-52 | CATACGATTTAGGTGACACTATAG-CCGCCCAGCGGGGGTAGGGCCGGACGTAGGAGGAGCTGCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-52 bound strongly to all three Gram-positive bacteria tested (S. aureus, E. faecalis and E. freudini). | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 11.97 ± 2.94 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0762 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-31 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 89 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-31 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 87.03 ± 17.32 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0763 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-55 | CATACGATTTAGGTGACACTATAG-CCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | The binding of P12-55 to E. coli cells was more than 100-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 161.0 ± 34.74 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0764 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-17 | CATACGATTTAGGTGACACTATAG-GACGGTGGCAGGGAAAGGGGTCGGGCATATGGCGGAGGGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | P12-17 could only bind to E. faecalis. The binding of P12-17 was 10-fold stronger than that of the random library. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 56.33 ± 15.87 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0765 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-11 | CATACGATTTAGGTGACACTATAG-CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA-ATTTCTCCTACTGGGATAGGTGGA | 85 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0766 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-21 | CATACGATTTAGGTGACACTATAG-CCGGAGGTGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGA-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0767 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-9 | CATACGATTTAGGTGACACTATAG-TGCGGGCGGAGGACACGGACCCGTATGGGAGCAATGCACG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0768 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-15 | CATACGATTTAGGTGACACTATAG-GGCCACCCACAGGCACTCCGCTCATGAATCGTGGAGTCGG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0769 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-30 | CATACGATTTAGGTGACACTATAG-CACCACGGACACGATCCCAAGCTAGGAGGTGCGGCGGGGT-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0770 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-48 | CATACGATTTAGGTGACACTATAG-TGGCACAGCACGTCGCACGGTCCCCGGGAGGTGTTCACTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0771 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-51 | CATACGATTTAGGTGACACTATAG-TCGCGAGTGCGTGTACGCCACACATCACAAAAGGGGTGTG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0772 | 27104834 | 2016 | Isolation of an Aptamer that Binds Specifically to E. coli | P12-66 | CATACGATTTAGGTGACACTATAG-GGCAACATTCAGACATACCAGTACCCACTCGGACTTCCCG-ATTTCTCCTACTGGGATAGGTGGA | 88 | 5'-CATACGATTTAGGTGACACTATAG-N40-ATTTCTCCTACTGGGATAGGTGGA-3' | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers that bind to E.coli and to three MNEC clinical isolates from septic patients. | N/A | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0773 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Composite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 12.4 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0774 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 25.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0775 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 14.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0795 | 26334590 | 2016 | Label-free and highly sensitive electrochemical detection of E. coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification | Anti-E. coli aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Label-free electrochemical biosensor using RCA coupled DNAzyme amplification for detecting E. coli. | Exhibits detection limits of 8 cfu/mL and a detection range of 5 orders of magnitude. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0810 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-E. coli | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0812 | 26641108 | 2016 | Dual Recognition Strategy for Specific and Sensitive Detection of Bacteria Using Aptamer-Coated Magnetic Beads and Antibiotic-Capped Gold Nanoclusters | SA-aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-coated magnetic beads (Apt-MB) and Van-functionalized fluorescent gold nanoclusters (AuNCs@Van) were employed for specific capture of SA. | Sensitive quantification of SA in the range of 32–10(8) cfu/mL with the detection limit of 16 cfu/mL via fluorescence intensity. | N/A | N/A | N/A | Biosensor | N/A | 5′-Biotinylated and 5′-Cyanine3 (Cy3) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0830 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt22 | GCTGTGTGACTCCTGCAA-GCGGGAAGAGGGTAAGGGGAGGGAGGGTAACGCGGAGAAGGCAA-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | Display LOD in PBS and serum of 1.5 nM and 2.1 nM, respectively, with an analytical linear range from 5 to 200 nM of FbpA. | 12 | Flow Cytometry | 62.95 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0831 | 29594592 | 2017 | Selection of DNA aptamers against Mycobacterium tuberculosis Ag85A, and its application in a graphene oxide-based fluorometric assay | Apt8 | GCTGTGTGACTCCTGCAA-TCAGGAAAGAACTTAGGGGTGGGAGGAGGGTATAAATACGGAAT-GCAGCTGTATCTTGTCTCC | 81 | 5'-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Antigen 85 (Ag85A) (FbpA) | Identify aptamers that bind to and develop a graphene oxide-based fluorometric assay to detect FbpA. | N/A | 12 | Flow Cytometry | 202 nM | Biosensor | Magnetic Bead (MB)-based Protein SELEX | ATTO647N-labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0832 | 28206680 | 2017 | A single-stranded DNA aptamer against mannose-capped lipoarabinomannan enhances anti-tuberculosis activity of macrophages through downregulation of lipid-sensing nuclear receptor peroxisome proliferator-activated receptor γ expression | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Downregulate PPARγ expression by blocking the binding of ManLAM to MR on macrophages, and ZXL1 enhances IL-1β and IL-12 mRNA expression and cytokine production in ManLAM-treated macrophages but decreases IL-10 production. | The percentage of macrophages that took up iH37Rv decreased from 15.9% to 7.2%, thereby inhibiting ManLAM-induced immunosuppression of DCs. | N/A | N/A | N/A | Therapeutics/Immunmodulatory | N/A | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0934 | 27825886 | 2017 | Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detection | E.coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Upconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk. | Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0946 | 28009914 | 2017 | Whole cell-SELEX of aptamers with a tyrosine-like side chain against live bacteria | 8.30A | GCGC(U^y)CGCGCGGCG(U^y)GC-ACAGAAAG(U^y)G(U^y)GGCCA(U^y)G(U^y)G(U^y)(U^y)G(U^y)G(U^y)CCC(U^y)GGCAGG(U^y)(U^y)AG(U^y)(U^y)(U^y)A-C(U^y)G(U^y)(U^y)GGCGCAGGCCGACGC | 81 | 5'-GCGCTCGCGCGGCGTGC-40N-CTGTTGGCGCAGGCCGACGC-3' | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify modified aptamers that were isolated against Escherichia coli DH5α cells. | N/A | 12 | Saturation Binding Assay | N/A | Detection | Whole Cell-SELEX | Phenol-modified dUTP (dU^yTP) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0961 | 28645756 | 2017 | An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkey | S. Typhimurium aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based PCR method coupled with magnetic immunoseparation was developed to detect S. Typhimurium from ground turkey. | Able to detect 10(2) CFU/mL of S. Typhimurium in pure culture, and 10(3) CFU/mL of S. Typhimurium in ground turkey. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0965 | 28287715 | 2017 | Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles | Aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Bacterial cell wall | Develop a dual-molecular FRET platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively, for the detection of pathogenic bacteria. | Shows a linear concentration of Staph. aureus in the range from 20 to 10(8) cfu/mL with a detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0967 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Indirect Dot-Blot Aptamer | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The limit of quantitation (LOQ) for indirect assays was 10(5) CFU/mL. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0977 | 28624620 | 2017 | AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensors | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a ECL aptasensor based on amine-functionalized E. coli aptamer and luminol/AgBr/3DNGH for the detection of E. coli. | Linear response range from 0.5 to 500 cfu/mL and Limit of Detection (LOD) of 0.17 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | No obvious change was observed for the response of a BSA/aptamer/GA/CHIT/luminol/AgBr/3DNGH/GCE when stored at 4°C for 12 d, indicating an acceptable stability of the aptasensor. | N/A | N/A | N/A |
| ABdb_0978 | 27526340 | 2017 | Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorods | S. typhimurium aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium. | Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0980 | 28691795 | 2017 | Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles. | The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0981 | 28159108 | 2017 | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | A chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet. | The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0998 | 28795534 | 2017 | Graphene Field-Effect Transistors for the Sensitive and Selective Detection of Escherichia coli Using Pyrene-Tagged DNA Aptamer | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Developed a biosensing platform using graphene field-effect transistors (APG-FETs) with the aid of pyrene-tagged DNA aptamers for E. coli detection. | Achieve a detection limit of 10(2) CFU/mL for E. coli within 72 s. | N/A | N/A | N/A | Biosensor | N/A | 5'-(pyrene derivate)-TTTT | N/A | N/A | N/A | N/A | N/A |
| ABdb_1007 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H70 | GTCTTGACTAGTTACGCC-CAGGACAGGTTAAAATTTTTCTGGATCCCTTTTCATTCTCCATGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1048 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-2 | TCAGCACGT-ATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGC-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | 75% binding affinity to V. parahaemolyticus than to other foodborne bacteria (less than 18%). | 8 | Flow Cytometry | 10.3 ± 4.5 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1049 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-1 | TCAGCACGT-AGCCCTATTTGTTTTCTCTTGTCTCTGTACTGCTGATGTTGGTCATTCTCTTTTCTCGGT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 19.2 ± 2.8 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1050 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-3 | TCAGCACGT-TATCTAGTCAGATATCCAGACAGTCGCGGCTGGAAGCTTCTGTTAAGAATTTGAGATACT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 25.2 ± 3.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1051 | 30685034 | 2018 | Selection of highly specific aptamers to Vibrio parahaemolyticus using cell-SELEX powered by functionalized graphene oxide and rolling circle amplification | Apt-4 | TCAGCACGT-GCGGGCATTATTGCACTCCACGGCGAGTAGTGCTCACAGAGTCATTTACACCGGTCGTAT-TCCACTGAGAGATCC | 84 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell (lipopolysaccharides (LPS) and Outer membrane protein (OMP) on V. parahaemolyticus cell surface) | Identify aptamers against a V. parahaemolyticus. | N/A | 8 | Flow Cytometry | 17.2 ± 5.1 nM | Detection | Advanced Cell-SELEX (with PC-GO and CRM-RCA) | 5ʹ-Phosphorylation or 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1067 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S1 | CAGTCCAGGACAGATTCGCGAG-TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | The limit of detection (LOD) was 1.46 × 10^3 CFU/mL, with a total detection time of 50 minutes. | 19 | Quartz Crystal Microbalance (QCM) | 10.30 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1068 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S2 | CAGTCCAGGACAGATTCGCGAG-GCGGGAATAGGATGCGGCTGGAAGGAGAGGTGTTGGTGGGTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1069 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S3 | CAGTCCAGGACAGATTCGCGAG-GTGCGGTGACGTGAGGGGGAGAGGCGTTGGTGTAGGCTGTTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1094 | 30413894 | 2018 | An impedimetric aptasensor for Shigella dysenteriae using a gold nanoparticle-modified glassy carbon electrode | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGGATTAGTCAAGAGGTAGACGCACATA | 87 | N/A | ssDNA | Shigella Dysenteriae (PTCC 1188) | Outer membrane protein (OMP) | Developed an impedimetric aptasensor using GCE modified with AuNPs for the detection of S. dysenteriae. | Display linear dynamic range that extends from 10(1) to 10(6) CFU/mL and a limit of detection of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1121 | 30187142 | 2018 | Colorimetric aptasensor for Campylobacter jejuni cells by exploiting the peroxidase like activity of Au@Pd nanoparticles | aptamer | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni | Surface protein | Develop a colorimetric aptasensor based on an aptamer and Au@Pd NPs peroxidase for the determination of C. jejuni in the milk sample. | The Limit of Detection (LOD) achieved was 10 CFU/mL in phosphate-buffered saline and 100 CFU/mL in milk samples with a linear range from 10 to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1122 | 29649475 | 2018 | Use of DNA aptamer for sandwich type detection of Listeria monocytogenes | LM6-116 | AGTATACGTATTACCTGCAGCTACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTGCGATATCTCGGAGATCTTGC | 81 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Surface protein | Develop a two-site binding sandwich assay for capture and detection of L. monocytogenes. | Display LOD of 2.5 CFU L. monocytogenes in 500 μl buffer and 10 CFU/25 g turkey deli meat sample. | N/A | N/A | 74.4 ± 52.69 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1123 | 29414089 | 2018 | A sensitive Potentiometric resolved ratiometric Photoelectrochemical aptasensor for Escherichia coli detection fabricated with non-metallic nanomaterials | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Surface protein | Develops a sensitive potentiometric resolved ratiometric photoelectrochemical aptasensor for the detection of E. coli. | Achieved an extremely low detection limit (LOD) of 0.66 cfu/mL and showed a wide linear range (2.9 cfu/mL to 2.9 × 10(6) cfu/mL). | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1180 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | Sa1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1181 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | E1 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1183 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C5 | CCTAACCGATATCACACTCAC-GGCTAGCGGACAGGTGTAGGTCGGAATCCTTCAGCGTAGA-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1184 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C7 | CCTAACCGATATCACACTCAC-AGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGAC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1185 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C10 | CCTAACCGATATCACACTCAC-GTAGTGAGGTGGGTCGTGAAGGGAGGCACTACTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1186 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C13 | CCTAACCGATATCACACTCAC-GAGGTGAGGGTGCGAGGGTAAGGGGGCAAACCTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1187 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C16 | CCTAACCGATATCACACTCAC-ACGTAGTGAGGGTTGCGAGGGTAAGGTGGTCAGTATACGC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1190 | 29078201 | 2018 | Gold atomic cluster mediated electrochemical aptasensor for the detection of lipopolysaccharide | LPS aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptamer immobilized gold atomic cluster mediated, ultrasensitive electrochemical biosensor (Apt/AuAC/Au) for LPS detection. | Achieved a detection of LPS down to 7.94 × 10–21 M level with a wide dynamic range from 0.01 attomolar to 1 pM. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | The Apt/AuAC/Au electrode offers excellent stability when stored at 4°C for 1 week, with 95.54% of the signal retained. | N/A | N/A | N/A |
| ABdb_1197 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt2) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | An aptasensor based on FRET between Rhodamine B and gold nanoparticles for the detection of Salmonella typhimurium was developed. | Achieved concentrations ranging from 1530 to 96938 CFU/mL, with a detection limit of 464 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1202 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | S. typ aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits of 150 cfu/mL in milk, 120 cfu/mL in human serum, and 120 cfu/mL in human urine for S. typ. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-FAM Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1229 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours, and the MIC for E. coli was approximately 0.1 and 1 μg/mL for gentamicin and amikacin, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1231 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for P. aeruginosa was approximately 1 μg/mL for both gentamicin and amikacin. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1256 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | D-Apt | CCTCAGCATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGCGCAGTGCACCCACCCACCCACCC | 90 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (3'-end phosphorylation) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1257 | 31307721 | 2019 | Dual-recognition surface-enhanced Raman scattering(SERS)biosensor for pathogenic bacteria detection by using vancomycin-SERS tags and aptamer-Fe3O4@Au | S. aureus-aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a dual-recognition SERS biosensor using Vancomycin-Au@MBA and aptamer-Fe3O4@Au for the detection of pathogenic bacteria. | A detection limit of 3 cells/mL with a wide dynamic linear range from 10 to 10(7) cells/mL can be achieved within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1258 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A3P | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | Exhibits a wide linear detection range (from 10(2) to 10(7) cfu/mL), and the detection limit could be as low as 10 cfu/mL. | N/A | Flow Cytometry | 50.76 ± 8.92 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1279 | 31617347 | 2019 | Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color Emission | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | An ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus. | The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1324 | 31732807 | 2019 | A glassy carbon electrode modified with reduced graphene oxide and gold nanoparticles for electrochemical aptasensing of lipopolysaccharides from Escherichia coli bacteria | LPS Aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 | Lipopolysaccharide (LPS) | An electrochemical aptasensor immobilized on a GCE modified with reduced graphene oxide and gold nanoparticles (RGO/AuNPs) was developed for the voltammetric determination of LPS from E. coli 055:B5. | Limit of Detection (LOD) of 1 fg/mL (using Mg/CQD media) or 30 fg/mL (using hexacyanoferrate). | N/A | N/A | 12 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1349 | 31953175 | 2020 | Single-stranded DNA (ssDNA) Aptamer targeting SipA protein inhibits Salmonella Enteritidis invasion of intestinal epithelial cells | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | SipA protein | Identify an aptamer targeting the SipA protein and interfere with the function of effector proteins to prevent host cell invasion. | 70% and 37.7% inhibition ratios against adhesion and invasion of S. enteritidis TM 6 to Caco-2 cells, 45.71% and 39.5% against those of S. enteritidis TM 68, respectively. | 9 | Fluorescence Spectroscopy | 114.9 nM (at 27°C) and 63.4nM (at 37°C) | Therapeutics | Magnetic Bead (MB)-based SELEX | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1357 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–5 | GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 3.9 ± 0.6 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1358 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–7 | GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 8 ± 0.9 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1359 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–10 | GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 10.1 ± 1.7 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1360 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-1 | GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA | 87 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1361 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-2 | GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1362 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-3 | GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA | 85 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1363 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-4 | GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1364 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-6 | GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1365 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-8 | GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1366 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-9 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1369 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (U433, U556-ESBL, B12327, U5307, U6267-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1375 | 32451800 | 2020 | Inhibition of Salmonella enteritidis biofilms by Salmonella invasion protein-targeting aptamer | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | Salmonella invasion proteinA (SipA) | An aptamer targets the SipA protein to inhibit Salmonella biofilm formation by interfering with the T3SS. | Co-incubation of Apt17 with ampicillin MIC/10 for 24 h inhibited the biofilms of S. enteritidis TM 6 and S. enteritidis TM 68 by 12.5% and 20.9% respectively. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1393 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF508 | TAGGGAAGAGAAGGACATATGAT-ACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | EF508 exhibited more than 20- to 800-fold higher binding to E. faecalis target cells than to non-target cells. | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 37 ± 4 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1405 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 1 | ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1406 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 2 | ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10(3) CFU/mL. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1407 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 3 | ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1408 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 4 | ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1409 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 5 | ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1438 | 32070611 | 2020 | Rapid and sensitive detection of Salmonella Typhimurium using nickel nanowire bridge for electrochemical impedance amplification | Aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor using an aptamer-coated gold interdigitated microelectrode and antibody-modified NiNWs to detect Salmonella typhimurium. | This electrochemical aptasensor quantitatively detected Salmonella at concentrations ranging from 10(2) to 10(6) CFU/mL within 2 h, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1453 | 34567619 | 2020 | An aptamer-based shear horizontal surface acoustic wave biosensor with a CVD-grown single-layered graphene film for high-sensitivity detection of a label-free endotoxin | Aptamer | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Endotoxin (Lipopolysaccharide (LPS)) | Developed SH-SAW biosensor with chemical vapour deposition (CVD)-grown single-layered graphene (SLG) for endotoxin detection. | The biosensor exhibited a linear detection range of 0-100 ng/mL and a detection limit (LOD) of 3.53 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1469 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | LPS-Apt | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Acinetobacter Baumannii | Lipopolysaccharide (LPS) | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1481 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap6 | TAGGGAAGAGAAGGACATATGAT-GCGCTGTGCGGATGTCATGATGTGCCTCTTCCCTGTGTCCGC-TTGACTAGTACATGACCACTTGA | 88 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | The detection limit of this aptasensor was as low as 10(5) CFU/ml within 10 minutes and a linear range of 10(5)-10(8) CFU/ml. | 10 | Flow Cytometry | 9.82 ± 3.6 nM | Biosensor | Whole Cell-SELEX | FITC Labeled | N/A | N/A | Best Candidate | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1494 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O1 | V.ch27 | GCCTGTTGTGAGCCTCCTAAC-GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCAC-CATGCTTATTCTTGTCTCC | 81 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | The binding efficiency for V.ch27 was 53.3%. | 12 | Flow Cytometry | 20.186 ± 3.655 pM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1529 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-5 | AAGGAGCAGCGTGGAGGTTA-CTCGTTTGGATACGTCATCGGTAGGACTACGGTACCTAAAC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | The binding ability order was HPA-2 > HPA-3 > HPA-5 > HPA-9. | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1537 | 33585756 | 2021 | Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers | HPA-13 | AAGGAGCAGCGTGGAGGTTA-ATCGCTCCGTCCAGTAAGAGTTGCCTACAATGCCCGCCGGC-ACCACGACGACACACCCTAA | 81 | 5'-AAGGAGCAGCGTGGAGGTTA-N40-ACCACGACGACACACCCTAA-3' | ssDNA | Helicobacter Pylori (ATCC 43504) | Whole cell | Identify aptamers that can detect H. pylori with no specificity for other bacteria. | N/A | 9 | Fluorescence Spectroscopy | N/A | Biosensor | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1553 | 34578762 | 2021 | Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective Biomarker | Aptamer | GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC | 90 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT6/CFP10 fusion proteins (EC proteins) | Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples. | Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1559 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | ATAGGAGTCACGACGACCAGAAGCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCGTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1575 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI31 | TAGCTCACTCATTAGGCACCAGCCGGAAGGACCAGCTAGCTCACTCATTAGGCACCGAAGTGTGGTGCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 186.1 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1578 | 33836431 | 2021 | Ultra-sensitive photoelectrochemical aptamer biosensor for detecting E. coli O157:H7 based on nonmetallic plasmonic two-dimensional hydrated defective tungsten oxide nanosheets coupling with nitrogen-doped graphene quantum dots (dWO3•H2O@N-GQDs) | E.coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a novel PEC aptasensor based on dWO3•H2O@N-GQDs for ultrasensitive detection of E. coli O157:H7. | Achieved a limit of detection of 0.05 CFU/mL and a wide linear detection range from 0.1 to 10(4) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1590 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | E. coli-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 35150) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1592 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | S. typhi-aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) for S. typhi was 25 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1599 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E1 | TAGGGAAGAGAAGGACATATGA-CGATTACCGGAGCTGTGTCACCGGGCGCCAGTTGATGTGG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1600 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E2 | TAGGGAAGAGAAGGACATATGA-TATGATGGGAGTAACGATTGTCCGACATGGTACCACCCCA-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1601 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E3 | TAGGGAAGAGAAGGACATATGA-GGTGCACCTCTCGCCCGAATCAGATCCCCACGGCGCCCCCTA-TTGACTAGTACATGACCACTTGA | 87 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1602 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E4 | TAGGGAAGAGAAGGACATATGA-ATCGGCTACGAGGTCCCGACTGCCGGACTGGCCCTTGGTC-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1603 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E5 | TAGGGAAGAGAAGGACATATGA-ACACCGCCACGATGCAACTGCCAAACGCACCGTACGCCTG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1604 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E6 | TAGGGAAGAGAAGGACATATGA-CGAGAGGCCGCTGGGTCTAGACGTCCGGGTGCCACTCGCG-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1605 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E7 | TAGGGAAGAGAAGGACATATGA-TAACGCCTGTAGTACTCCACCTTAATCCGTTGCCAGGAAT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | N/A | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1608 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su12 | GGGAGUCGACCGACCAGAA-CAUACUGAGUAAGAUCGGAAAUUUCGGUGUAAGGCCACGG-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | Significantly reduced biofilm formation by 61.2%. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1609 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su057 | GGGAGUCGACCGACCAGAA-UGGAUGUAUGGAACUUGCAGAUCUUAACUGCACGAAGCGU-UAUGUGCGUCUACAUCUAGACUCAU | 84 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1610 | 35745014 | 2022 | The Ability of Nuclease-Resistant RNA Aptamer against Streptococcus suis Serotype 2, Strain P1/7 to Reduce Biofilm Formation In Vitro | R8-su15 | GGGAGUCGACCGACCAGAA-ACACGUUGCUGAAACAUACCGAGUAACAUAAAGCGGGUG-UAUGUGCGUCUACAUCUAGACUCAU | 83 | 5'-AGTAATACGACTCACTATAGGGAGTCGACCGACCAGAA-N40-TATGTGCGTCTACATCTAGACTCAT-3' | ssRNA | Streptococcus Suis serotype 2, strain P1/7 | Whole cell | Identify aptamers that inhibit the biofilm formation of the S. suis target strain. | N/A | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Therapeutics | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1611 | 35573794 | 2022 | Aptamer-Targeted Drug Delivery for Staphylococcus aureus Biofilm | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Whole cell | Aptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm. | SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modified | N/A | SA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period. | N/A | N/A | N/A |
| ABdb_1629 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt1 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | Display a linear range between 7.0 × 10(4) and 7.0 × 10(7) CFU/mL, and the limit of detection of SWV was 7.0 × 10(4) CFU/mL. | 8 | Fluorescence Spectroscopy | 11 nM | Biosensor | Whole Cell-SELEX | FAM Labeled and Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1630 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGTGTACGTATCATTTATGCTTTAATAGTGTGCCGTTGTTGCTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1631 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt3 | ATCCAGAGTGACGCAGCA-TGACGGGTAGGACTTCCTGTGTTAGGTTGTAATGTTGGTGAAGCGTCCCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1632 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt4 | ATCCAGAGTGACGCAGCA-TGGGGCCGGACAGGGCAAACTGGCTGAAGCGGAGGGTGTCGGCGCCGCTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1633 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt5 | ATCCAGAGTGACGCAGCA-TGAGGGGAGGTAAGGGGTGAGCTCGCATGTACCGTTGGGAGAGGGGGGGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1634 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt6 | ATCCAGAGTGACGCAGCA-TGTGGGCAAGTCGGTGACGAACCAGGTGTCAAGGTCCTGCGCGCTCGCAC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1635 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt7 | ATCCAGAGTGACGCAGCA-TGGAGCGGTGGGCACGGTTGGGTCGCGTGGATGGAGGCGGGCGTGTGCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1636 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt8 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1637 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt9 | ATCCAGAGTGACGCAGCA-CGAACGTTAGACGATTTGTGCAGTAGTGGCCACAGCCTAATCGTGTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1638 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt10 | ATCCAGAGTGACGCAGCA-TGCCAGTATGCCCACTCTCATTCGGCTTCTTTGTGTTGCATGTTACGCCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1641 | https:doi.org10.1016j.snb.2022.132752 | 2022 | Novel nanozyme-catalyzed and magnetically assisted colorimetric biosensor for Staphylococcus aureus detection with a low matrix effect from complex environments | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Vancomycin-modified magnetic nanoparticles (Fe3O4 @Au-Van MNPs) combined with an aptamer were prepared for S. aureus detection. | The biosensor can distinguish more than 100 CFU/mL of pathogens by the naked eye and LOD of 2 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1642 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-59 | CATGACACCGTACCTGCTCT-TGCTTTTCGTGCGCGCATAAAATACCTTGATACTGTGCCGTATGAAAGCG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | OspA limit-of-detection determined to be 1 × 10−4 ng/mL with 91% sensitivity and 96% specificity. | 10 | Fluorescence anisotropy (FA) | 2.18 nM | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1643 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-21 | CATGACACCGTACCTGCTCT-AATAAGCACGCCAGGGACTATTAGATCGGAATAGCACACGTCTGAACTCC-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1644 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-46 | CATGACACCGTACCTGCTCT-AATAAGCACGCCAGGGACTATTAGATCGGAAGAGCACACGTGTGAACTCC-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1645 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-22 | CATGACACCGTACCTGCTCT-ACGAGATTCAAGCACTCCAGGGACTATTAGATCGGAAGAGCACACGTCTG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1646 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-39 | CATGACACCGTACCTGCTCT-ACGAGATTCAAGCACGCCAGGGATTATTAGATCGGAAGAGCACACGTCTG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1647 | 35104673 | 2022 | An antigen-targeting assay for Lyme disease: Combining aptamers and SERS to detect the OspA protein | Ion-OspA-55 | CATGACACCGTACCTGCTCT-TGCTTTTCGTGCGCGCATAAAATACTTTGATACTGTGCCGGATGAAAGCG-AAGCACGCCAGGGACTATTA | 90 | 5'-CATGACACCGTACCTGCTCT-N50-AAGCACGCCAGGGACTATTA-3' | ssDNA | Borrelia Burgdorferi | Outer Surface Protein A (OspA) | Develop SERS-based aptasensor to detect OspA in serum samples. | N/A | 10 | Fluorescence anisotropy (FA) | N/A | Biosensor | RAPID-SELEX | 5'-DTPA dithiol and T at 86 position is replaced by 5-Octadiynyl dU moeity | N/A | N/A | N/A | N/A | N/A |
| ABdb_1650 | 35869107 | 2022 | An innovative dual recognition aptasensor for specific detection of Staphylococcus aureus based on Au/Fe3O4 binary hybrid | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an imprinted aptasensor (apt-AuNPs@ Fe3O4) for the quantification of S. aureus. | Exhibited a wide linear range of 10(1)-10(7) CFU/mL with a Limit of Detection (LOD ) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | The aptasensor retained approximately 95% of its original activity for four weeks. | N/A | N/A | N/A |
| ABdb_1651 | 35829778 | 2022 | An ultrasensitive sandwich-type electrochemical aptasensor using silver nanoparticle/titanium carbide nanocomposites for the determination of Staphylococcus aureus in milk | Apts | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 23656) | Whole cell | Developed a novel sandwich-type electrochemical aptasensor using AgNPs@Ti3C2 nanocomposites for the detection of S. aureus. | Showed a low detection limit (LOD) of 1 CFU/mL and a linear range of 52–5.2 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | 92.68% of the initial current of the aptasensor was reserved when stored for 15 days at 4°C. | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1672 | 35850461 | 2022 | Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction | Aptamer | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Enterococcus Faecalis | Whole cell | Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity. | aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1686 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 28,06 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1687 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1688 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 31,99 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1689 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5,21 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1690 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 8,89 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1691 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1692 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,84 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1693 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1694 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,79 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1695 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,53 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1696 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 45,36 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1697 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1698 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S8-7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | N/A | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17.18 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1718 | 36058939 | 2022 | Multiple amplification-based fluorometric aptasensor for highly sensitive detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a fluorometric aptasensor for the detection of S. aureus using magnetic nanoparticles (MNPs). | The proposed fluorometric aptasensor displays LOD of (1.23 cfu/mL, a wide linear range (1 ~ 10(8) cfu/mL), and a fast detection speed (~ 1.5 h). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1748 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | 214.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1749 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt1_RC | ATCCAGAGTGACGCAGCA-GCGGCAGCCACCCAACGACCACGCTCATCCTCCTCCCCCGCACCGTCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | Using SWV, exhibiting a linear detection range of 4.0 × 10(4)–7.0 × 10(7) CFU/mL, and a limit of detection of 4.0 × 10(4) CFU/mL at pH 5.0. | 8 | Fluorescence Spectroscopy | 3.4 nM | Biosensor | Whole Cell-SELEX | FAM Labeled and Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1750 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGGGGCATGGGAAGGTGGGTAAGCCGTTGCGTGGGATGTGGCGGGTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1751 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2_RC | ATCCAGAGTGACGCAGCA-GACCCGCCACATCCCACGCAACGGCTTACCCACCTTCCCATGCCCCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1752 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3 | ATCCAGAGTGACGCAGCA-TGGGGCGAAGGACGGTGGATGTGTGTAGGCGCGGGTGGGTCGCACGGGGT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1753 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3_RC | ATCCAGAGTGACGCAGCA-ACCCCGTGCGACCCACCCGCGCCTACACACATCCACCGTCCTTCGCCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1754 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1755 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4_RC | ATCCAGAGTGACGCAGCA-CAGCGCGCGCTTCTCACTCCCCGCCCCCGTCGTGTCTCTCCCGTCTGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1756 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5 | ATCCAGAGTGACGCAGCA-TGTGGCGGTGGCAAGGTCGGTGGGTGCGGCGGCGTACCGGTGGTGGGGGG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1757 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5_RC | ATCCAGAGTGACGCAGCA-CCCCCCACCACCGGTACGCCGCCGCACCCACCGACCTTGCCACCGCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1758 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6 | ATCCAGAGTGACGCAGCA-TGACCGGCGGGGGGTGGTTCGCTGATAGGGCGTGTGGACCGGGGGTCGCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1759 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6_RC | ATCCAGAGTGACGCAGCA-TGCGACCCCCGGTCCACACGCCCTATCAGCGAACCACCCCCCGCCGGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1760 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7 | ATCCAGAGTGACGCAGCA-TGGGCGGGTAGTGGGGCAACGTGAGCGCGTGGGGTGTGGCAGGCGTGGCT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1761 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7_RC | ATCCAGAGTGACGCAGCA-AGCCACGCCTGCCACACCCCACGCGCTCACGTTGCCCCACTACCCGCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1762 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8 | ATCCAGAGTGACGCAGCA-AGATGACTTAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1763 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8_RC | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTAAGTCATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1764 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9 | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCATCGAGTGTA-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1765 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9_RC | ATCCAGAGTGACGCAGCA-TACACTCGATGACACACTCTTTCCCTACACGACGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1766 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10 | ATCCAGAGTGACGCAGCA-TGGGTGTGGTGGCGCGGGTGGCGTGGTGCGTGTACAGCTGGTTGCGGGCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1767 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10_RC | ATCCAGAGTGACGCAGCA-CGCCCGCAACCAGCTGTACACGCACCACGCCACCCGCGCCACCACACCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1784 | https://doi.org/10.1016/j.snb.2023.133554 | 2023 | A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRs | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus. | Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1792 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt (mono-apt) | GAGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | N/A | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 389.63 nM (with mono-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1840 | 38770656 | 2024 | Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy Transfer | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a CRISPR/Cas 13a-assisted CRET-based strategy for the detection of S. aureus in real samples. | Successfully detected S. aureus in drinking water and milk with detection limits of 20 and 30 cfu/mL, respectively, within the recovery of 90.07–105.50%. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1844 | 38150965 | 2024 | Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuni | ONS-23 | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33291) | Whole cell | Developed a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni. | Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1846 | 38169279 | 2024 | "Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal application | Anti-S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 65389) | Whole cell | A fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs). | The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1855 | 38805947 | 2024 | Aptamer-functionalized Fe3O4/MWCNTs@Mo-CDs nanozyme for rapid colorimetric detection toward Escherichia coli | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8099) | Whole cell | Peroxidase (POD)-like Fe3O4/MWCNTs@Mo-CDs (FMMC) nanozyme was developed for the colorimetric detection of E. coli. | Had a wide linear range of 10(1)–10(6) CFU/mL, low LOD of 0.978 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1889 | 39894103 | 2025 | Introduce a novel, extremely sensitive aptamer against staphylococcal enterotoxin type D | Aptamer 1 | CCTAACCGATATCACACTCAC-GGGTGCAGCCCGGAGCGGCTTGCATGATTGGGTTGGTGGG-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-N40-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin D (SED) | Isolate high-affinity ssDNA aptamers with specificity for SED. | The limit of detection (LOD) for SED was determined to be 45 nM. | 10 | Surface Plasmon Resonance (SPR) and Enzyme-Linked Apta-Sorbent Assay (ELASA) | 4.4 ± 2.26 nM (by SPR) and 13.43 nM (by ELASA) | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1906 | 40947925 | 2025 | Smartphone-Based Fluorescence/Colorimetric Dual-Mode Aptasensor for the Detection of Salmonella Using Multivalent Aptamer and CHA Amplification | Aptamer | GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a dual-mode portable fluorescent/colorimetric aptasensor, leveraging multivalent aptamer competitive assays and catalytic hairpin assembly (CHA) for the detection of Salmonella. | Enables the quantitative detection of Salmonella within a linear range of 10 to 10(7) CFU/mL, with detection limits of 28 CFU/mL for colorimetric detection and 10 CFU/mL for fluorescent detection. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1911 | 40839054 | 2025 | SERS-based aptasensor for culture-free detection of Escherichia coli in urinary tract infection diagnosis | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Developed a SERS-based aptasensor for the detection of E. coli. | Demonstrated a detection limit of 5.9 × 10(3) CFU/mL, which is well below the UTI cutoff value. | N/A | N/A | N/A | Biosensor | N/A | 3'-BHQ2 | N/A | N/A | N/A | N/A | N/A |
| ABdb_1912 | 40437283 | 2025 | Target-triggered hybrid chain amplified fluorescence aptasensor based on label-free dye and MnO2 nanosheets system for Escherichia coli detection | AwI | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACCTGTACAAATCGTCTTGAT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed a label-free fluorescent detection system leveraging target-triggered hybridization chain reaction (HCR) amplification for E. coli detection. | Exhibited a detection limit of 17 CFU/mL and a broad dynamic range from 5.0 × 10(1) ~ 5.0 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1915 | 40016920 | 2025 | Cascaded Strand Displacement Amplification and CRISPR/Cas12a Aptasensor Utilizing MoS2 Nanoflowers for Colorectal Cancer Biomarker Porphyromonas gingivalis Detection | Apt-Pg1 | TGACTGACGACGACTC-AGTGGAGTATCGCCTTGCCGACCCGGGTGTCTACGATCAGTGAGTGGTAGT-GACTGCTCGAGCTG | 81 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Identify specific aptamers targeting P. gingivalis and develop an aptasensor based on MoS2 nanoflowers that integrates strand displacement amplification and CRISPR/Cas12a double-amplification for detection. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1927 | 39406088 | 2025 | Laser-induced graphene-based aptasensor for the selective detection of Escherichia coli in urine samples | P12-55 | CATACGATTTAGGTGACACTATAGCCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGAATTTCTCCTACTGGGATAGGTGGA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an impedance biosensor using a Laser-Induced Graphene-based (LIG) electrode for the detection of E. coli in urine samples. | The aptasensor showed a linear response to E. coli over the range 10(0)-10(3) CFU/mL and LOD of 9 CFU/mL in PBS. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1945 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt1 & Apt3 | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1950 | 41135162 | 2026 | Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensor | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA | 86 | N/A | ssDNA | Shigella Dysenteriae | Whole cell | Developed an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae. | MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Long stability of up to 28 days at 4°C. | N/A | N/A | N/A |