Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 125
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0001 | 12799428 | 2003 | A DNA Spiegelmer to staphylococcal enterotoxin B | B12b10_65 | GACGTCTTCGAATCCCCATACTGTGGCATTGGCTCAGGACGGTCTGGAGGATGGGGCTTGACGTG | 65 | 5'-TCAGCTGGACGTCTTCGAAT-N60-TGTCAGGAGCTCGAATTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (Full-length protein and short SEB peptides) | Identify aptamers against the L-configured peptide and the full-length SEB protein. | N/A | 12 | Surface Plasmon Resonance (SPR) | 200 ± 20 (against short SEB peptide) and 420 nM (Full length SEB protein) | Detection | Mirror-Image SELEX | L-DNA Spiegelmer | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0058 | 19751419 | 2009 | Antibiotic resistance in bacteria: novel metalloenzyme inhibitors | Metallo-β-lactamase-targeting aptamers | CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC | 61 | 5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3' | ssDNA | Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56 | Metallo-β-lactamase active sites | Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme. | LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively. | 21 | Metallo-β-lactamase activity assays | Ki = 0.92 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0090 | 22166202 | 2011 | In vitro selection of Escherichia coli O157:H7-specific RNA aptamer | Two Arm ( from clone I-1) | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | 5'-GGGAUACCAGCUUAUUCAAUU-N60-AGAUAGUAAGUGCAAUCU-3' | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | Whole cell | Identify aptamers that bind to and distinguish between the virulent serotype and the nonpathogenic strain of E.coli. | Specifically bound to the lipopolysaccharide, which includes the O antigen from the O157:H7 strain, but not to the LPS from the K12 strain. | 6 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | ~110 nM | Detection | Subtractive SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and A(16) extended on the 3' | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0236 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA17 | TCCCTACGGCGCTAAC-CCCCCCAGTCCGTCCTCCCAGCCTCACACC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 312 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 35 nM and 3.03 nM for SA17-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0237 | 23689505 | 2013 | Rapid single cell detection of Staphylococcus aureus by aptamer-conjugated gold nanoparticles | SA61 | TCCCTACGGCGCTAAC-CTCCCAACCGCTCCACCCTGCCTCCGCCTC-GCCACCGTGCTACAAC | 62 | 5'-TCCCTACGGCGCTAAC-N30-GCCACCGTGCTACAAC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC: 6538DR) | Whole cell | Identify aptamers that binds to and recognize strains of S.aureus using aptamer-conjugated gold nanoparticles. | LOD was 1250 bacterial cells, and the lower limit of detection of the instrument was 63 ± 21 GNPs/μl for 100-nm particles and 508 ± 176 GNPs/μl for 60-nm particles. | 8 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 129 nM and 9.9 nM for SA61-GNPs | Biosensor | Whole Cell-SELEX | Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0358 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-27 | ACGGCTCGCACTCTCTGATTT-GGCATAGCTGCCGGGAGGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | The binding signal of EcA5-27 for E. coli NSM59 was notably higher (~ 1.5-fold) than for laboratory strains of E. coli, and 8.5- and 56-fold to additional uropathogenic isolates compared with laboratory strains. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 110 nM | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0359 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-01 | ACGGCTCGCACTCTCTGATTT-CGGCACCCCGTCGCTATGTTGACC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0360 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-02 | ACGGCTCGCACTCTCTGATTT-GGGGAGGTGGCGACCGCTTCTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0361 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-03 | ACGGCTCGCACTCTCTGATTT-GGGGTCAGATATTAAACCGTGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0362 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-04 | ACGGCTCGCACTCTCTGATTT-GGGAGAGGGAGTGGTCTGGGAGAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0363 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-05 | ACGGCTCGCACTCTCTGATTT-GCGGGCTTCGACACAGTGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0364 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-06 | ACGGCTCGCACTCTCTGATTT-GGGAGGGGCGGCGAAGGAGTGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0365 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-07 | ACGGCTCGCACTCTCTGATTT-GGAAGCGGTGGGGATCGTGTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0366 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-08 | ACGGCTCGCACTCTCTGATTT-GGGAGCAAATCCGGAATGTGGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0367 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-09 | ACGGCTCGCACTCTCTGATTT-GGCGGAGGGGTTCGGGGTTGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0368 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-10 | ACGGCTCGCACTCTCTGATTT-GGCGGGGCGTGGGGGATGTGTGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0369 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-11 | ACGGCTCGCACTCTCTGATTT-GGAATGCGAAGTGTGGCCTAGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0370 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-12 | ACGGCTCGCACTCTCTGATTT-GGGCGGGGGGGGATTCCGAGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0371 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-13 | ACGGCTCGCACTCTCTGATTT-GGGGGGGTGGCATTTTGGGGTGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0372 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-14 | ACGGCTCGCACTCTCTGATTT-GCGGGGAAAGAGAAGGAAGCGTCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0373 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-15 | ACGGCTCGCACTCTCTGATTT-GGGCCCGAGTGGCGGTAGTTTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0374 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-16 | ACGGCTCGCACTCTCTGATTT-GGGGGGTGGTGAAGGCCTGGGGGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0375 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-17 | ACGGCTCGCACTCTCTGATTT-GGGCCGGAGGGGCGCCTGCACCCA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0376 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-18 | ACGGCTCGCACTCTCTGATTT-GGGGTTAGGCGAGGGGGGTGGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0377 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-19 | ACGGCTCGCACTCTCTGATTT-CGGACGGTAGGGAAGGGGGGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0378 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-20 | ACGGCTCGCACTCTCTGATTT-GGCGAGGCAGGGTGCGGGGGCCCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0379 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-21 | ACGGCTCGCACTCTCTGATTT-GCGTGTGGTGGGTGAGGGGTCTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0380 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-22 | ACGGCTCGCACTCTCTGATTT-GGGGATAGCAGGACAATGAGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0381 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-23 | ACGGCTCGCACTCTCTGATTT-GGCCGCGTGTGTGTCCGACTGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0382 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-24 | ACGGCTCGCACTCTCTGATTT-GGGCGAGGAGAGAGGCGGAGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0383 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-25 | ACGGCTCGCACTCTCTGATTT-GCCGTGGTGTGTGTGATGGTCGGT-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0384 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-26 | ACGGCTCGCACTCTCTGATTT-GGCTTGGCTCCTCACGGGGGGTGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0385 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-28 | ACGGCTCGCACTCTCTGATTT-GGAGGGGTTGACCATGACCGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0386 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-29 | ACGGCTCGCACTCTCTGATTT-GGGGGAAGGGCCAATGGATTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0677 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A24P.A2 | AGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCT | 69 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0712 | https://doi.org/10.1080/00032719.2015.1052974 | 2015 | Determination of Shigella flexneri by a Novel Fluorescent Aptasensor | Aptamer1 | CCTCATGTCGAACAGCAACACTGCAACACTGTATAGTCCTGTGTGCCTTGAGCGTTTATTCTGAGCT | 67 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed a homogeneous fluorescent aptasensor using a dye-labelled aptamer and graphene oxide, using target recycling amplification for Shigella flexneri detection. | A linear relationship was displayed from 500 to 10(9) CFU/mL with a limit of detection of 100 CFU/mL. | N/A | N/A | 29 ± 4 nM | Biosensor | N/A | Carboxyfluorescein-GGGCCC at the 5' and 3' ends | N/A | N/A | N/A | N/A | N/A |
| ABdb_0760 | https:doi.org10.1016j.carbon.2016.04.014 | 2016 | Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug delivery | Polyaptamer (PA) | ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT | 70 | N/A | ssDNA | Escherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus) | Kanamycin (Kan) | Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects. | Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Phosphate | N/A | N/A | N/A | N/A | N/A |
| ABdb_0796 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC2 | TGCAGGATCCGGTATCCGTGGACGGTGTGCAGGATCCGGTATCCGTGGGCACGAGAATTCCTCCGTTGCG | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | LOD in the minimum quantity of 5 ng SEB per 100 µl of human serum. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.3 × 10(−11) M | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0797 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC3 | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0800 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC9 | ACGAGAATTCCTCCGTTGCGGCACAGTTGGGCAGGAACCTGTGGGGCGTGCGCAACGGAGGAATTCTCGT | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0803 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC12 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACAGGATCCTGCATGCCTGTCCACGGATACCGGATCCTCA | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0819 | 27209574 | 2016 | A paper based graphene-nanocauliflower hybrid composite for point of care biosensing | RNA Aptamer | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | N/A | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | O-antigen | Develop electrochemical biosensing platform using graphene paper functionalized with fractal platinum nanocauliflower for detection of E. coli O157:H7. | Detection limit (LOD) of ~4 CFU/mL with linear range of 4 to 10(5) CFU/mL and a response time of 12 min. | N/A | N/A | 110 nM | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0849 | 28941453 | 2017 | Development of a DNA Aptamer for Screening Neisseria meningitidis Serogroup B by Cell SELEX | K3 | GCCTGTTGTGAGCCTCCTAACGCCAGGCGTTTTGGCCGTAGGCGTGGGAGACAAGAATAAGCA | 63 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Neisseria Meningitidis Serogroup B (ATCC 13090) | Whole cell | Identity aptamers bind to and detect N. meningitidis in patients’ CSF samples. | Detected 10(2) CFU of CSF isolated N. meningitidis. | 6 | Flow Cytometry | 28.3 ± 8.9 pM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0956 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | S.aureus-AptamerS | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | Exhibited a linear concentration, ranging from 10(1) to 10(7) cfu/mL with the detection limit of 1.5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0969 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 2 | TCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCT | 61 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0970 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 3 | TCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCT | 65 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | The sensor has a linear calibration range of 1-150 ng/mL and a detection limit of 50 pg/mL, quantitatively, with the portable spectrophotometer, and 20 ng/mL, semi-quantitatively, with the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0971 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 4 | TCTCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCTCT | 69 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1080 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTCCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-functionalized QD and UCNP nanoprobes conjugated with partially complementary DNA-modified magnetic beads for separation of different bacteria. | The limit of detection was 15 cfu/mL for S. aureus with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1200 | 29533818 | 2018 | Culture-free, highly sensitive, quantitative detection of bacteria from minimally processed samples using fluorescence imaging by smartphone | S. aureus–specific aptamer (Sap) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (USA300) | Surface protein | Developed a smartphone-based detection using aptamer-functionalized fluorescent magnetic nanoparticles (FMNPs) for Staphylococcus aureus. | Showed a minimum detectable concentration as low as 10 cfu/ml in a peanut milk sample within 10 min. | N/A | N/A | 3.03 nM | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1327 | 31446952 | 2019 | Aptamer-based SERS biosensor for whole cell analytical detection of E. coli O157:H7 | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | SERS-based aptasensor using 4-aminothiophenol-gold nanoparticle complexes was developed for the detection of E. coli O157:H7. | Low concentrations of E. coli O157:H7 were detected and quantified within 20 min in both pure culture (∼10(1) CFU/mL) and ground beef samples (∼10(2) CFU/mL), and a linear range from 10(2) to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1338 | 30622036 | 2019 | An electrochemical aptasensor for staphylococcal enterotoxin B detection based on reduced graphene oxide and gold nano-urchins | Aptamer SEB | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | An electrochemical aptasensor was developed using a screen-printed electrode modified with reduced graphene oxide (rGO) and gold nano-urchins (AuNUs) for the detection of SEB. | A wide linear range of 5.0–500.0 fM was observed, with a detection limit of 0.21 fM. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1344 | 31033156 | 2019 | Inkjet Printed Nanopatterned Aptamer-Based Sensors for Improved Optical Detection of Foodborne Pathogens | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed an inkjet-printed nanopatterned aptamer-based sensor for optical detection of E. coli O157:H7. | Display a LOD of 25 CFU/mL in pure culture and 233 CFU/mL in ground beef. | N/A | Bio-Layer Interferometry (BLI) | N/A | Biosensor | N/A | 5'-Carboxy and 5'-Biotin-TEG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1367 | 32499557 | 2020 | Identification of two aptamers binding to Legionella pneumophila with high affinity and specificity | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Legionella Pneumophila (Lp 120292) | Whole cell | Identify an aptamer against Lp and utilise it as a biorecognition element in a biosensor to detect Lp in real-time and in situ. | Around 60% of lp120292 cells are stained by R10C5 and 20% of Pseudomonas strains. | 10 | Flow Cytometry | 116 nM | Biosensor | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1374 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 6 | ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA | 70 | N/A | ssDNA | Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1402 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-1 | AAAAAAAAAAAAAAAAAAAACCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 62 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1415 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V8 | AGTATACGTATTACCTGCAGC-CAATCATGACCGCCCACCTCACTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell (Cell wall protein) | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | The LOD of the V8 from cytometry is 29.96 CFU/mL, and the linear range is 102–5 × 105 CFU/mL. | 13 | Flow Cytometry | 11.22 ± 1.30 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1416 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V9 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1417 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V11 | AGTATACGTATTACCTGCAGC-TCCCAACCAATACCAGTACGTTGTA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1418 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V12 | AGTATACGTATTACCTGCAGC-TATGGATTTGCGTCATGTTTATGTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1419 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V13 | AGTATACGTATTACCTGCAGC-CCAACCCTATGCTTCAACGGTCTTT-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | 15.47 ± 0.39 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | V8 and V13 can tolerate diluted serum as well as oyster infusion. | Best Candidate | N/A | N/A |
| ABdb_1420 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V18 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGTGGGTGGTATCTGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1421 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V20 | AGTATACGTATTACCTGCAGC-CATCCCCTCTCCTGTTGCCCTGACA-GCAAAGATCTCCGAGATATCG | 67 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1422 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V28 | AGTATACGTATTACCTGCAGC-CCTGGACATCATTGAGTACTCGTCT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1423 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V31 | AGTATACGTATTACCTGCAGC-TGTGGGTGGGATTAGGTTCGGGTGG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1424 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V38 | AGTATACGTATTACCTGCAGC-CCAGACTTCAATCGCGTCAACCGTT-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1425 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V39 | AGTATACGTATTACCTGCAGC-TGATGGTTGTATGACTGGATGTCAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1426 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V40 | AGTATACGTATTACCTGCAGC-TCCCCTTTGCATGGCGGTGACACTG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1427 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V41 | AGTATACGTATTACCTGCAGC-CACCTAGAACACATTGCAACATTAG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1428 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V44 | AGTATACGTATTACCTGCAGC-TGCTCCTCGACTGTTGTTAATCGTG-GCAGATCTCCGAGATATCG | 65 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1429 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V49 | AGTATACGTATTACCTGCAGC-TGACATCGTCTGACCTCCACAAGCA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1430 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V53 | AGTATACGTATTACCTGCAGC-TGGGTCCGTATGTTGGTGTATGTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1431 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V59 | AGTATACGTATTACCTGCAGC-TGTATACCCGACCGTACCGACGTAA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1432 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V69 | AGTATACGTATTACCTGCAGC-TCACCTTCACACACTCCCTTCTTCG-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1433 | 35493682 | 2020 | Isolation ssDNA aptamers specific for both live and viable but nonculturable state Vibrio vulnificus using whole bacteria-SEILEX technology | V71 | AGTATACGTATTACCTGCAGC-CCTGTACAAGCAGTATGTCAGCTGA-GCAAGATCTCCGAGATATCG | 66 | 5'-AGTATACGTATTACCTGCAGC-N25-GCAAGATCTCCGAGATATCG-3' | ssDNA | Vibrio Vulnificus (ATCC 27562) | Whole cell | Isolate aptamers that specifically bind V. vulnificus across all culture phases. | N/A | 13 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1467 | 32980107 | 2020 | A novel method combining aptamer-Ag10NPs based microfluidic biochip with bright field imaging for detection of KPC-2-expressing bacteria | XK10 | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | N/A | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a PDMS/glass microfluidic biochip integrated with aptamer-modified Ag(10)NPs nano-biosensors to detect whether bacteria express KPC-2. | Detects the target bacterium with a detection limit of 10(2) CFU and a capture efficiency exceeding 90% in ∼1 h. | 8 | Surface Plasmon Resonance (SPR) | 0.81 nM | Biosensor | Protein SELEX and Whole Cell-SELEX | 5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1504 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-10 (truncated) | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | The detection limit of Biotin-XK-10 was 104 CFU/mL, and that of Biotin-Ag-XK-10 was 103 CFU/mL. | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | 0.81 ± 0.13 nM (by SPR) and 12.9 ± 1.03 nM (by microarray chip) | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1574 | 33582948 | 2021 | Selection and Characterization of Cell Surface Specific Aptamer and Development of Fluorescence Assay for Detection of Shigella flexneri from Water Samples | SHI27 | TAGCTCACTCATTAGGCACATGGCAAGGTTGCCTTTTTGAGCGCGCTGCATAGTTAAGCCAGCC | 64 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Shigella Flexneri (ATCC 9199) | Whole cell | Identify aptamers and develop a fluorescence-based assay for direct detection of S. flexneri from water samples. | N/A | 10 | Flow Cytometry | 328.9 nM | Detection | Whole Cell-SELEX | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1739 | https://doi.org/10.1016/j.snb.2021.130933 | 2022 | Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophila | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | N/A | ssDNA | Legionella Pneumophila (Lp) strain Lp02 | Whole cell | SPRi-based titration assay using Lp aptamer for detecting L. pneumophila. | The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1740 | 36108985 | 2022 | Naked-eye detection of Staphylococcus aureus in powdered milk and infant formula using gold nanoparticles | Anti-S. aureus aptamer (Apt1) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (FPR3757 USA300) | Whole cell | Developed a colorimetric LSPR aptasensor using gold nanoparticles for the detection of S. aureus in milk and infant formula. | Could be visually detected within 30 min, with detection limits of 7.5 × 10(4) CFU/mL and 8.4 × 10(4) CFU/mL in milk and infant formula, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1742 | 36199343 | 2022 | Dual-mode sensor based on the synergy of magnetic separation and functionalized probes for the ultrasensitive detection of Clostridium perfringens | DNA walker Aptamer | TTTTTTTTTTTTTTTTTTTTTACAGAGCACGGGAATGTTACTGCCTGTTCAACGGCAGTAACATTAGC | 68 | N/A | ssDNA | Clostridium Perfringens | C. perfringens genomic DNA | Developed a dual-mode aptasensor using the synergy between fluorescent and electrochemical signals based on a DNA walker and hybridization chain reaction (HCR) for Clostridium perfringens detection. | Displayed an excellent analytical performance for C. perfringens at a concentration of 1 to 10(8) CFU/g and a minimum concentration of 1 CFU/g in real samples. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1799 | 36961921 | 2023 | Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell Level | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt). | The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | After storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal. | N/A | N/A | N/A |
| ABdb_1810 | 37437266 | 2023 | Specific Instantaneous Detection of Klebsiella pneumoniae for UTI Diagnosis with a Plasmonic Gold Nanoparticle Conjugated Aptasensor | KPBA1 | GGCTGGATGGGGCGTGT-GGAGCCCCGTTAGAATATCAGAGGTGGTGG-CAACGGTGCGGACAGCG | 64 | 5'-GGCTGGATGGGGCGTGT-30N-CAACGGTGCGGACAGCG-3' | ssDNA | Klebsiella Pneumoniae (MTCC-7028) | Whole cell | Developed localized surface plasmon resonance (LSPR) aptasensor using a tailor-made plasmonic aptamer-gold nanoparticle (AuNP) for detection of Klebsiella pneumoniae. | LoD as low as 3.4 × 10(3) CFU/mL within 5 min. | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5′-Thiolated (5′-/5ThioMC6-D) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1830 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Apt1 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (RN4220) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1831 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Sp14 | AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG | 69 | N/A | ssDNA | Bacillus Cereus (ATCC 14579) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |