Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 200
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0043 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag1 | TAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGATG | 39 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0044 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | mag1 | TGAGCCCCACTAAAGTTGCAATCATGTCGTCAGCTTTGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0045 | 18803393 | 2008 | Selection of aptamers against live bacterial cells | hemag3 | CGTCGCGGCATATTTCCAGTGGAACGGTTACGATATGTTG | 40 | 5'-AGCAGCACAGAGGTCAGATG-40N-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Surface protein (S-layer protein) | Identify aptamers that bind only specifically to cells with S-layers composed of similar S-proteins (L. acidophilus 4355, 4356, and 4357) and not to other cells (E. coli, S. bovis, and S. cerevisiae). | N/A | 8 | Flow Cytometry | N/A | Detection | SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0095 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A1 | CAGAACGCACCCGCACACCTCCATCACTCGCATGCACCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 72% gated fluorescence intensity above the library. | 20 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0097 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 20A8 binding to the target GAS cells yielded 72% gated fluorescence above background. | 20 | Flow Cytometry | 4 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0099 | 21504182 | 2011 | DNA aptamers binding to multiple prevalent M-types of Streptococcus pyogenes | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | Whole cell | Identify aptamers against the various M-types of S. pyogenes. | 65% gated fluorescence intensity above the library. | 20 | Flow Cytometry | 9 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0126 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A1 was 64%. | 9 | Flow Cytometry | 22.92 ± 4.72 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0128 | 22480209 | 2012 | Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | 5'-ATAGGAGTCACGACGACCAGAA-N40-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify aptamers against V. parahemolyticus and develop molecular probes for its detection in food and environmental samples. | The gated fluorescence intensity above background for A3 was 75%. | 9 | Flow Cytometry | 24.03 ± 5.18 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0141 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0144 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0215 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 82 ± 2.34% for ST2. | 9 | Flow Cytometry | 16.34 ± 0.45 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0218 | 23473545 | 2013 | Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium SELEX | ST9 | AATCAATAGAAGACAAAGTCCGAAACAGGTGTGACGGTAA | 40 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (Lipopolysaccharide (LPS) or lipoprotein) of whole cell | Identify an aptamer that binds to and develop a fluorescent bioassay based on aptamer-MNPs conjugate to detect S. typhimurium. | Gated fluorescence intensity above background remained at 72 ± 1.57% for ST9. | 9 | Flow Cytometry | 9.45 ± 0.63 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0340 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. enterica (FASE) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 61.0 cfu/mL (S. enterica) and linear ranges of 42.2–675.0 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0341 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA I | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGC | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0342 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA II | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0413 | 24445115 | 2014 | An aptamer-based electrochemical biosensor for the detection of Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Aptamer-based electrochemical biosensor for Salmonella detection. | A detection limit of 3 cfu/mL was achieved, with a linear range of 2.4 cfu/mL to 2.4 × 10^3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0417 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT17 | CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0418 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT12 | CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0419 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT11 | CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0420 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT9 | CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0421 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT8 | CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0422 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT7 | CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0423 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT6 | CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0424 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5 | CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0425 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5.1 | CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0426 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT4 | CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0433 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | ST-apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A universal fluorescent aptasensor based on the AccuBlue dye was developed for the detection of pathogenic bacteria. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 25 cfu/mL in 1.5 h for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0434 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | VP-apt | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer is hybridized with complementary DNA (cDNA) to form fluorescent dsDNA. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 35 cfu/mL in 1.5 h for V. parahaemolyticus. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0454 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0455 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0500 | 25016253 | 2014 | Evanescent wave DNA-aptamer biosensor based on long period gratings for the specific recognition of E. coli outer membrane proteins | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | A label-free remote evanescent wave fibre optic sensor using long-period gratings (LPGs) was developed for the detection of EcOMPs. | Displayed linear responses in the range of 0.1 nM to 10 nM EcOMPs and LOD of 10 nM in less than 1 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0559 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-CA 20 | CACACACGGAACCCCGACAACATACATACGGTGAGGGTGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 7 ± 1 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0561 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | D-Cells 9 | GGGGAGGAGAAAAAGAGGACCAGAGTAACGATTCGTGGGG | 40 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | Showed a 55% increase in the gated fluorescence intensities above background. | 8 | Flow Cytometry | 71 ± 23 nM | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0564 | 26678795 | 2015 | An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes | E-Cells 1 | GGGGAGGAGAAAAGAGGACCAGAGTAACGATTCGTGGGG | 39 | N/A | ssDNA | Streptococcus Pyogenes M types | M proteins (M11) | Identify aptamers selective for S. pyogenes and some of its M-types. | N/A | 8 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0628 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA1 | UUCAGGGACCAGUGUUUGCCUUGUGCCAGUC | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 108 ± 33.4 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0673 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Sty-apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0675 | https://doi.org/10.1007/s00604-015-1649-7 | 2015 | Impedimetric Salmonella aptasensor using a glassy carbon electrode modified with an electrodeposited composite consisting of reduced graphene oxide and carbon nanotubes | Anti-Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Develop a label-free impedimetric aptasensor based on an amino-modified aptamer bound to rGO-MWCNT composite for the detection of Salmonella. | Exhibits a linear range from 75 to 7.5 × 10(5) cfu/mL and a detection limit of 25 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0687 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A8 | CCCCACGAATCGTTACTCTGGTCCTCTATTTCTCCTCCCC | 40 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0689 | 25940316 | 2015 | Retargeting pre-existing human antibodies to a bacterial pathogen with an alpha-Gal conjugated aptamer | 20A9 | CACACGCTGAAGAAACTGAGGTCGTAGGTTTTCTTCGGG | 39 | N/A | ssDNA | Group A Streptococcus (GAS) M serotypes | M protein | Evaluate the ability of alphamer (aptamer conjugated to an α-Gal epitope at its 5′ end) to redirect pre-existing anti-Gal antibodies to the GAS surface and promote opsonophagocytic clearance in vitro. | N/A | N/A | Flow Cytometry | N/A | Therapeutics | N/A | 5' or 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0692 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0693 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 2 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0700 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0702 | 25467500 | 2015 | Pathogen detection in complex samples by quartz crystal microbalance sensor coupled to aptamer functionalized core-shell type magnetic separation | Aptamer | CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-based QCM biosensor for the determination of Salmonella in food samples. | Showed specific detection of Salmonella cells at 100 CFU/mL from a milk sample and a linear response range from 100 to 4 × 10(4) CFU/mL cells. | N/A | Quartz Crystal Microbalance (QCM) | 3259 CFU mL−1 | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0704 | https://doi.org/10.1039/C4AY02880E | 2015 | Rapid and sensitive detection of Salmonella typhimurium using aptamer-conjugated carbon dots as fluorescence probe | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a fluorescence probe based on amino-modified aptamer conjugated to carboxyl-modified carbon dots (CDs) for detection of Salmonella typhimurium. | Limit of Detection (LOD): 50 cfu mL⁻¹ and linear range of 10(3)-10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0705 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 4 Rev | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0706 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 3 Rev | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | Exhibited a linear range of 10-10(4) cfu/mL and the detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0707 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0724 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 45 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC | 40 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0725 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 60 | CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG | 37 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0726 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 1 | CGAAGGGGCTATGCCGCCTACATAGACCGTCACGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0727 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 2 | GGCCGGCAATACGGCCGAGCCCGGGGTTCCTCCGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0728 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 3 | GCCACGCGCAGCAATCAAACCCGGCCCCCTGCTCC | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0729 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 4 | TGGCCAGAGTACGAGTAAGGGAGGTCACAACCTTA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |
| ABdb_0776 | 27871171 | 2016 | Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats | Ec3 (31) -Truncated | UUCAAUUGCACGAAUUUGCUGUGUUUUUGGG | 31 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Identify an aptamer that binds specifically to E. coli, and use the minimized Ec-3(31) aptamer to develop detection assays. | Ec3(31)-biotin-streptavidin magnetic separation has LOD of 1.3 × 10(6) CFU/ml, Optical analytic technique has LOD of 5 × 10(4) CFU/ml, and Electrochemical Impedance Spectroscopy (EIS) has LOD of 2 × 10(4) CFU/mL of E. coli cells. | 12 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 225 nM | Biosensor | Whole Cell-SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) or 3'-Biotinylated or Thiolated or Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0801 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC10 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACC | 33 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0802 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC11 | TGCAGGATCCGGTATCCGTGCGCAACGGAGGAATTCTCGT | 40 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0806 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0807 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-X-rhodamine (ROX) modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0811 | 27404735 | 2016 | Highly sensitive detection of lipopolysaccharides using an aptasensor based on hybridization chain reaction | Detection probe | GTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGA | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptasensor assay based on hybridization chain reaction (HCR) to detect LPS. | Display a relatively low detection limit (1.73 ng/mL) with a linear response range of 1–10(5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0818 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 28 cfu/mL (S. typhimurium). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0822 | https://doi.org/10.1039/C6AY02623K | 2016 | SERS aptasensor detection of Salmonella typhimurium using a magnetic gold nanoparticle and gold nanoparticle based sandwich structure | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a SERS aptasensor using aptamer-functionalized magnetic gold nanoparticles (MGNPs) and mercaptobenzoic acid (4-MBA) functionalized gold nanoparticles (GNPs) based sandwich structure for the detection of S. typhimurium. | Exhibit a good linear range from 10 cfu/mL to 10(7) cfu/mL, and the LOD is 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0884 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB2 | CCGGGCAGCGGTCAATGCCGCACCTTCCATATGATCGGGG | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | BB2 showed a lower binding affinity than the aptamer BB2p. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0885 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10 | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0886 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16 | CTCCCAGGCCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 40 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | Demonstrated higher binding affinity than the original full-length aptamer. | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0887 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-6f | GGCCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTT | 34 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0890 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-2r | CCCCCTGCCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 38 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0891 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB10-9r | CCTGCCAAAAAGGTGTTGCCAGGTTGGCGGC | 31 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0896 | https://doi.org/10.1039/C6RA27672E | 2017 | Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve | BB16-8r | CCGTTGGGGCGTTGCCTGCGTGCACCCGGGGC | 32 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bifidobacterium Breve (ATCC 15700) | Whole cell | Identify aptamers that bind to and develop colorimetric sandwich-type assay to detect B. breve in milk samples. | N/A | 12 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0948 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0949 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0952 | https://doi.org/10.1016/j.foodcont.2017.07.016 | 2017 | SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a novel SGNPs-based SERS aptasensor functionalized with p-MBA for the detection of S. typhimurium. | Display linear range 10(1) cfu/mL to 10(5) cfu/mL, with a limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated or Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0954 | 29051620 | 2017 | Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus | Apt(His) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Vibrio Vulnificus (MO6-24/O) | V. vulnificus-infected HeLa cells | The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity. | Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) | HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM. | N/A | N/A | N/A | N/A |
| ABdb_0957 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | L.mono-AptamerL | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21633) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | N/A | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0958 | 28107686 | 2017 | A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Colorimetric aptasensor was developed based on color changing GNPs for the detection of S. typhimurium. | Quantitative detection of S. typhimurium from 10(2) to 10(7) cfu/mL with a detection limit as low as 56 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0959 | 28107930 | 2017 | A chemiluminescent aptasensor based on rolling circle amplification and Co2+/N-(aminobutyl)-N-(ethylisoluminol) functional flowerlike gold nanoparticles for Salmonella typhimurium detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Chemiluminescent aptasensor based on rolling circle amplification (RCA) using Co2+/ABEI-AuNFs-cDNA complex was developed for the detection of S. typhimurium. | The limit of detection (LOD) was 10 cfu/mL. The method exhibited excellent selectivity over non-target bacteria. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated (Biotin-TTTTTT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0960 | 29030671 | 2017 | Graphene-based label-free electrochemical aptasensor for rapid and sensitive detection of foodborne pathogen | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | rGO-azophloxine (AP) nanocomposite aptasensor was developed for the detection of foodborne pathogens. | Exhibited a linear range of detection from 10(8) to 10(1) cfu/mL with a detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Aptasensor showed good stability for up to 20 days, with a 5.1% increase in current response when stored in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_0972 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 1 (Capture) | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | The limit of detection (LOD) of 11 cfu/mL, and the detection range was 11 to 1.10 × 10(5) cfu/mL of S. typhimurium in buffer solution. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0976 | 28860462 | 2017 | Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | Develop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples. | Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0982 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-01 | CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0983 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-02 | CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0984 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-03 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0985 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-04 | ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 39 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0986 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-05 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC | 38 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0987 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-06 | GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0988 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-07 | GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0989 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-08 | GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0990 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-09 | GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0991 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-10 | AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0992 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-11 | AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0993 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-12 | GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-12 showed better affinity to E. coli and S. epidermidis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0994 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-13 | GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0997 | https://doi.org/10.1007/s12161-017-0864-8 | 2017 | Fabricating a Novel Raman Spectroscopy-Based Aptasensor for Rapidly Sensing Salmonella typhimurium | S. typhimurium aptamer (STA) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a surface-enhanced Raman scattering (SERS) based aptasensor with Raman active molecule attached GNRs and cDNA for the detection of Salmonella typhimurium (ST). | Observed linear ST concentration from 56 to 56 × 10(7) cfu/mL with a LOD of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0999 | https://doi.org/10.1007/s00604-017-2383-0 | 2017 | Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus | Vp-aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus. | Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response. | N/A | N/A | N/A |
| ABdb_1000 | https://doi.org/10.1016/j.jelechem.2017.10.054 | 2017 | Development of an aptasensor using reduced graphene oxide chitosan complex to detect Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-CHI electrochemical aptasensor to detect Salmonella. | Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1024 | 29580944 | 2018 | Inhibition of anthrax lethal factor by ssDNA aptamers | ML7 | GGAGAGAGGGAGACGCGCAACCTCGACCCGT | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Lethal factor (LF) | Identify aptamers against LF and interfere with the interaction with its substrate MEK1 by blocking the active site of LF to prevent protease activity. | N/A | 8 | Fluorescence Spectroscopy | N/A | Therapeutics | SELEX | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1066 | 29896641 | 2018 | Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop SERS-based aptasensor using DNA-assembled gold nanodimers (AuNDs) for detection of S. typhimurium. | Display a linear range in the 10(2) to 10(7) cfu/mL, and the limit of detection is 35 cfu/mL within 1hr. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1081 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 28 cfu/mL for L. monocytogenes with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1083 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 12 cfu/mL for S. typhimurium with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1124 | 29870692 | 2018 | Carbon nanotube-based aptasensor for sensitive electrochemical detection of whole-cell Salmonella | Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an amino-modified aptasensor using MWCNTs-deposited ITO electrode for the detection of Salmonella. | It possesses a linear range from 10 mV/s to 90 mV /s, and the detection limit was 5.5 × 10(1) cfu/mL and 6.7 × 10(1) cfu/mL for S. Enteritidis and S. Typhimurium, respectively. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1151 | 29777309 | 2018 | Fluorometric determination of Vibrio parahaemolyticus using an F0F1-ATPase-based aptamer and labeled chromatophores | V. parahaemolyticus aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an F0F1-ATPase-based aptasensor for the fluorometric determination of V. parahaemolyticus. | The relative fluorescence varies linearly over the 15 to 1.5 × 10(6) cfu/mL Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1191 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy employing an ultrasensitive aptasensor for the voltammetric determination of M. tuberculosis. antigen MPT64 in human serum. | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1192 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy where two different aptamers are immobilized on a gold electrode to synergistically bind the target MPT64 protein | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1198 | 30359519 | 2018 | Ω-Shaped Fiber-Optic Probe-Based Localized Surface Plasmon Resonance Biosensor for Real-Time Detection of Salmonella Typhimurium | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-immobilized Ω-shaped fiber-optic localized surface plasmon resonance (FOLSPR) biosensor for S. Typhimurium detection. | Achieved high detection sensitivity for S. Typhimurium down to 128 CFU/mL within a linear range from 5 × 10(2) to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1199 | https://doi.org/10.1016/j.snb.2017.08.160 | 2018 | Nanoporous gold as a suitable substrate for preparation of a new sensitive electrochemical aptasensor for detection of Salmonella typhimurium | Anti-S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a label-free electrochemical aptasensor based on nanoporous gold (NPG/Au/GCE) for the detection of Salmonella typhimurium. | Capable of detecting S. typhimurium in a wide linear dynamic range 6.5 × 10(2) to 6.5 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1225 | 31216306 | 2019 | Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dots | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop an aptamer-based (Apt-MNPs) fluorescence assay for the determination of Salmonella Typhimurium. | Exhibit a linear range of 10 to 10(10) cfu/mL with LOD of 1 cfu/mL within 2 h, and is successfully applied to the analysis of spiked food samples with good recoveries from 90% to 105%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1226 | 31403764 | 2019 | Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe | Aptamer A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Mycoplasma-Infected Cells (Jeko-1 lymphoma cells) | Whole cell | Develop an aptamer probe for the rapid detection of mycoplasma-infected cells. | Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells. | 15 | Flow Cytometry | 24.5 nM | Detection | Whole Cell-SELEX | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1228 | 31183576 | 2019 | Surface-enhanced Raman spectroscopic single step detection of Vibrio parahaemolyticus using gold coated polydimethylsiloxane as the active substrate and aptamer modified gold nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-based SERS method using Au-PDMS film for the detection of V. parahaemolyticus. | The detection limit is 12 cfu/mL with a wide linear range from 1.2 × 10(2) to 1.2 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1235 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer2 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1245 | 30825657 | 2019 | A reduced graphene oxide-titanium dioxide nanocomposite based electrochemical aptasensor for rapid and sensitive detection of Salmonella enterica | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-TiO2 electrochemical aptasensor for the detection of Salmonella bacteria. | Exhibited high sensitivity with a wide detection range (10(8) to 10(1) cfu/mL), a low detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Showed good durability up to 21 days with a 10% decrease in signal after 30 days of non-use. | N/A | N/A | N/A |
| ABdb_1252 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA40 | CCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTC | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1253 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA36 | GCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGC | 36 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | LA36 has good specificity. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1259 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 32.53 ± 6.86 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1275 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | General aptamer (G-probe) | AGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCT | 39 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Ethanolamine | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1280 | 31036183 | 2019 | Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensor | B. melitensis aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis | Whole cell | A QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples. | The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL. | 15 | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1325 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅰ (MAA Ⅰ) | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1326 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅱ (MAA Ⅱ) | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1329 | 31410576 | 2019 | Electrochemical determination of Salmonella typhimurium by using aptamer-loaded gold nanoparticles and a composite prepared from a metal-organic framework (type UiO-67) and graphene | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An aptamer-based assay based on a metal-organic framework-graphene composite of type UiO-67/GR and an aptamer-gold nanoparticles-horseradish peroxidase (Apt-AuNP-HRP) conjugate is described for the determination of S.typhimurium. | Linear detection range from 2 × 10(1) – 2 × 10(8) cfu/mL and a lower detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | 91.3% of the original current is retained after storage at 4°C for 14 days with the modified electrodes, allowing monitoring of 2 × 10(5) cfu/mL S. typhimurium. | N/A | N/A | N/A |
| ABdb_1346 | https://doi.org/10.1016/j.foodcont.2018.11.048 | 2019 | Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor | Sh. flexneri binding aptamer | CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG | 40 | N/A | ssDNA | Shigella Flexneri (ATCC 12022) | Whole cell | Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri. | Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less. | 14 | N/A | 42.6 ± 7.11 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1382 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt B | CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 38 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Penicillin binding protein 2a (PBP2a) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1413 | https://doi.org/10.3390/IECB2020-07079 | 2020 | Detection of Listeria innocua by Acoustic Aptasensor | Aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Innocua | Whole cell | QCM-based aptasensor for the detection of pathogenic bacteria Listeria innocua. | The achieved limit of detection was approximately 1.6 × 10(3) CFU/mL and broad range of 5 × 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1440 | 31655050 | 2020 | Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensor | S. Typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica. | Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | ssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_1441 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1442 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A16-1Y | TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1454 | 33241794 | 2020 | Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticles | S. typhimurium aptamer | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce. | Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1475 | 32774812 | 2020 | Point-of-care detection of Escherichia coli O157:H7 in water using AuNPs-based aptasensor | Apt 2 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (EHEC) (NTCC 12900) | Whole cell | Developed an aptamer-based AuNPs bioassay to detect EHEC in contaminated water. | Exhibited a good linear response over a wide concentration range of 876 to 107 CFU/mL and a low detection limit (LOD) of 263 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1496 | https://doi.org/10.1016/j.sbsr.2019.100313 | 2020 | Aptamer-NanoZyme mediated sensing platform for the rapid detection of Escherichia coli in fruit juice | Aptamer P12–31(EC 12–31 TRUNC) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | An aptamer and NanoZyme-based colorimetric and electrochemical assay was developed for EC detection in fruit juice. | Displayed superior linearity in the range of 10–10(9) CFUs/mL and a low-end detection limit of ~10 CFU within 5 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1497 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt1 | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1501 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 27 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1505 | 33379005 | 2021 | Screening aptamers for serine β-lactamase-expressing bacteria with Precision-SELEX | XK-1 | ACCCCATATCGCGTCAAATTTGGCTACCTCACATGCCCAC | 40 | 5'-GACAGGCAGGACACCGTAAC-N40-CTGCTACCTCCCTCCTCTTC-3' (Library I) and 5'-GACAGGCAGGACACCGTAACNNNGTCCNNNNNGGACNNGCCNNNNGGCNNNGTTACGGTGCTGCTACCTCCCTCCTCTTC-3' (Library II) | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Identify aptamers that specifically recognize KPC-2 and KPC-2 E. coli. | N/A | 4 | Surface Plasmon Resonance (SPR) and Microarray Chip | N/A | Biosensor | Precision-SELEX (Protein SELEX and Whole Cell-SELEX) | Biotinylated or FITC or TAMRA Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1541 | 33285125 | 2021 | An aptamer biosensor based dual signal amplification system for the detection of salmonella typhimurium | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ASI 1174) | Whole cell | Developed a signal-cascade-amplification method named “immuno-HCR-SERS” for the detection of S. typhimurium. | Highly sensitive detection showing a linear range from 10 to 10(5) CFU/mL, with a limit of detection (LOD) of 6 CFU/mL in 3.5 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1542 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Capture aptamer (Bapt) | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1543 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Target aptamer (Tapt) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1549 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1550 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1556 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1557 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1558 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1563 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A6 | GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1564 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A16 | GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1565 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1587 | 33590378 | 2021 | Sensitive colorimetric aptasensor based on g-C3N4@Cu2O composites for detection of Salmonella typhimurium in food and water | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A colorimetric aptasensor using graphitic carbon nitride (g-C3N4) nanosheets and copper oxide(I) (Cu2O) nanocrystals was developed for detecting S. typhimurium. | Exhibited linear range from 1.5 × 10(1) to 1.5 × 10(5) CFU/ml, with a detection limit of 15 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1591 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | L. mono-aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Listeria Monocytogenes | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for L. mono. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1598 | 10.33263/BRIAC112.87028715 | 2021 | Novel Competitive Voltammetric Aptasensor Based on Electrospun Carbon Nanofibers-Gold Nanoparticles Modified Graphite Electrode for Salmonella enterica serovar Detection | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor based on aptamer-linked GNPs/CNF-Chi/GEs for the detection of Salmonella enterica Serovar. | Exhibited a linear range of 10 to 10(5) CFU/mL with the limit of detection (LOD) 1.223 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1620 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-1 | GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1621 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-2 | GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1622 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-3 | TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1623 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-4 | TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1624 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-5 | CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1625 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-6 | CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1626 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-7 | GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1628 | 35842460 | 2022 | DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalis | Aptamer | TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA | 39 | N/A | ssDNA | Porphyromonas Gingivalis | Whole cell | DNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT). | MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | FAM Labeled | At high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%. | N/A | N/A | N/A | N/A |
| ABdb_1655 | https://doi.org/10.1016/j.snb.2022.131654 | 2022 | Dual recognition and highly sensitive detection of Listeria monocytogenes in food by fluorescence enhancement effect based on Fe3O4@ZIF-8-aptamer | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a fluorescence enhancement effect-based detection strategy based on Fe3O4@ZIF-8@aptamer for L. monocytogenes. | The linear range for detection of pure culture was 1.4 × 10(1) to 1.4 × 10(7) CFU/mL, with a detection limit of 0.88 CFU/mL in about 70 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1671 | 34329020 | 2022 | Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollution | A15-HP-Am | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA | 40 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115 and ATCC 7644) | Whole cell | BAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria. | Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml. | N/A | N/A | N/A | N/A |
| ABdb_1715 | 35448289 | 2022 | Aptamer-Based Fluorescence Detection and Selective Disinfection of Salmonella Typhimurium by Using Hollow Carbon Nitride Nanosphere | S. typhimurium Apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop an off-on fluorescence aptasensor for the detection of S. typhimurium and use HCNS-Cap for disinfection. | The fluorescence assay showed a linear range of 30 to 3 × 10(4) CFU/mL and a detection limit of 13 CFU/mL. The bactericidal efficiency of HCNS-Cap (95.0%) within 12 h was better than that of HCNS (85.1%) and Cap (72.9%). | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1716 | 36205828 | 2022 | Aptamer-AuNP-conjugated carboxymethyl chitosan-functionalized graphene oxide for colorimetric identification of Salmonella typhimurium | S. typhimurium Aptamer | GCGCTCGGCCTCCTCTGCCATCTCATTCGCGAGCC | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a novel aptamer-AuNP-conjugated carboxymethyl chitosan–functionalized graphene oxide (CMC/GO@Apt-Au NP) probe for the determination of S. typhimurium. | Achieved a linear range from 10(2) to 10(7) CFU/mL with a limit of detection (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The relative response of aptasensor decreased to ~ 77% within 11 days of storage. | N/A | N/A | N/A |
| ABdb_1717 | 34693471 | 2022 | Electrochemical biosensor for detecting pathogenic bacteria based on a hybridization chain reaction and CRISPR-Cas12a | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An electrochemical biosensor platform based on HCR-based CRISPR-Cas12a for specific detection of S. typhimurium. | Selectively and sensitively quantify S. typhimurium in samples with detection limits of 20 CFU/mL and a linear range of 10-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1719 | 34986439 | 2022 | Potentiometric aptasensing of Escherichia coli based on electrogenerated chemiluminescence as a highly sensitive readout | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 | Whole cell | Developed a potentiometric aptasensor by electrogenerated chemiluminescence (ECL) using SWCNTs-aptamer modified electrode to detect E. coli. | Shows a highly sensitive response to E. coli O157: H7 in the linear range of 5-1000 CFU/mL with a low detection limit of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1743 | 36192057 | 2022 | Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplification | Aptamer 2 | CCTCCCTCCCTCCCTTTTTCCCACCCACCCACC | 33 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Developed an aptamer-based colorimetry sensor using a CRISPR/Cas12a system and recombinase polymerase amplification (RPA) for sensitive detection of MRSA. | MRSA was detected as low as 8 CFU/mL and can be quantified with a linear range of 10 CFU/mL to 10(5) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1744 | 35275270 | 2022 | DNAzyme-controlled plasmonic coupling for SERS-based determination of Salmonella typhimurium using hybridization chain reaction self-assembled G-quadruplex | Apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a SERS aptasensor based on hybridization chain reaction (HCR) self-assembled G-quadruplex DNAzyme (GQH DNAzyme)-controlled plasmonic coupling for S. typhimurium detection. | Display a linear range from 5 to 5.0 × 10(5) cfu/mL and the limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1745 | https://doi.org/10.1016/j.snb.2021.130839 | 2022 | A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobe | V.P-Apt | TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA | 38 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps. | Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The electrochemical signal retained 89.6% of its original value after 2 weeks. | N/A | N/A | N/A |
| ABdb_1798 | 37187062 | 2023 | A universal bacterial sensor created by integrating a light modulating aptamer complex with photoelectrochemical signal readout | Peptidoglycan aptamer | GCAGTTGCGGGACAGGGAGTGCGCTGCTCCCC | 32 | N/A | ssDNA | Escherichia Coli (E. Coli) | Peptidoglycan | Developed a signal-on photoelectrochemical biosensor for detecting peptidoglycan. | Demonstrate a limit-of-detection of 82 pg/mL (13 pM) in buffer and 239 pg/mL (37 pM) in urine for peptidoglycan and 1913 CFU/mL for Escherichia coli in urine. | N/A | N/A | 0.415 ± 0.047 μM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1827 | 37311299 | 2023 | Joint concanavalin A-aptamer enabled dual recognition for anti-interference visual detection of Salmonella typhimurium in complex food matrices | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A dual recognition platform based on Concanavalin A (Con A)-aptamer joint strategy for sensitive determination of S. typhimurium. | Exhibited linear range of 7.0 × 10(1) ∼ 7.0 × 10(9) CFU/mL, along with a detection limit as low as 23 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1839 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1842 | 39533298 | 2024 | Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric method | B. melitensis-specific aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccine | Whole cell | Detection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction. | Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1854 | 39096325 | 2024 | Colorimetric aptasensor for Listeria monocytogenes detection using dual functional Fe3O4@MIL-100(Fe) with magnetic separation and oxidase-like activities in food samples | Aptamer | TACTATCGCGGGAGACAGCGCGGGAGGCACCGGGGA | 36 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a colorimetric aptasensor based on magnetic responsiveness and oxidase-like activity of Fe3O4@MIL-100(Fe) for the detection of L.monocytogenes. | The linear range was from 10(2) to 10(7) CFU/mL, with the limit of detection as low as 14 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1865 | 37619471 | 2024 | A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and Aliarcobacter | C01 | CGCGTGTCTGCTGTCAATCGCAAGGTCCATGTCCCGCG | 38 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560) | Whole cell | Developed a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter. | Exhibited a wide detection range of up to 1 × 10(7) CFU/mL and the lowest limit of detection (LOD) of 1 CFU/mL, for each bacterium. | 12 | Fluorescence Binding Assay | 27.69 ± 5.66 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1871 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. enterica aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL. | N/A | Flow Cytometry | 8.9 ± 2.0 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1893 | 41245639 | 2025 | Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor | MPT64 aptamer sequence (17) | GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC | 40 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE). | Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT) | N/A | The aptasensor maintained good storage stability for up to 22 days. | N/A | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1905 | 41123678 | 2025 | Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beverages | IsdA-specific aptamer | GCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU | 40 | N/A | ssRNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples. | The lowest detection limit for S. aureus was 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1910 | 40931301 | 2025 | A novel fluorescent aptasensor using magnetic silica nanospheres and Ag@MOF nanocomposites for extraction and detection of Salmonella Typhimurium in eggs | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGCATTATGACAG | 39 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (PTCC 1709) | Whole cell | Developed a fluorescent platform based on an aptamer-Ag@MOF and Fe3O4@KCC‐1 probes for the detection of S. Typhimurium in eggs. | Achieved a linear detection range of 7.5 to 7.5 × 10⁶ CFU/mL, a detection limit of 4.61 CFU/mL, and a total detection time of 90 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1988 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4520–8 | PCGGCPPCGGGPACCPAPPAPCGGPPPAGCCCAGPCAGAA | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Staphylococcus aureus Protein A (SpA) | Developed slow off-rate modified aptamer (SOMAmer) reagents against S. aureus cell surface-associated proteins, used to capture and detect S. aureus. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·22 nM | Detection | SELEX | P=NapdU (5-naphthylmethyl-aminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1989 | 24935714 | 2014 | Specific capture and detection of Staphylococcus aureus with high-affinity modified aptamers to cell surface components | 4503–73 | AZCZGGZZCAAAGZGGCGAZZGGGCAZCZGGZZZZZAAGZ | 40 | N/A | ssDNA | Staphylococcus aureus (S. aureus) NRS384 (USA300) | Clumping factor A (ClfA) | Developed slow off-rate modified aptamer (SOMAmer) reagents to several Staphylococcus aureus cell surface-associated proteins via SELEX. | Efficient capture of Staph. aureus over a wide range of cell densities from 5 × 10(2) CFU/ml to 5 × 10(9) CFU/ml. | 8 | Radiolabel Filter Binding Assay | 0·79 nM | Detection | SELEX | Z=BndU (5-benzylaminocarbonyl-dU) and 5′biotin-dA or 5′fluorescein-biotin-dA and 3’-Inverted Thymidine (3'-idT) | N/A | N/A | Best Candidate | N/A | N/A |