Length : 121 - 130

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0844	28818557	2017	DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method	AM-5	CGTGATGATGTTGAGTTG-GAGTTGCGTTGCTGAATGCATGGGCTGTACTAGGTTGGTGCTACTCTGTAATGTCTACTATTACTATTCCATCGCAACGTATACTG-CAGTAATGCCAACCAATCT	123	5'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Identify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.	57.41% fluorescent cell intensity for E. coli O157 with less cross-reactivity.	10	Flow Cytometry	120.4 ± 32.2 pM	Detection	Whole Cell-SELEX	FITC Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1337	31080198	2019	Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens	30A-S2	AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA	123	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus.	N/A	N/A	N/A	N/A	Biosensor	N/A	5'-PolyA (30A) and Five thymine (5T)	N/A	N/A	N/A	N/A	N/A