AptBacterialDB

Length : 111 - 120

Total records found: 6

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0843 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-6CGTGATGATGTTGAGTTG-GGGTGATGGGTGCATGTGATGAAAGGGGTTCGTGCTATGCTGTTTTGTCTAATAATACTAGTCCTTGCCAAGGTTTATTC-CAGTAATGCCAACCAATCT1175'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.66.26% fluorescent cell intensity for E. coli O157 with less cross-reactivity.10Flow Cytometry107.6 ± 67.8 pMDetectionWhole Cell-SELEXFITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0845 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-1CGTGATGATGTTGAGTTG-GCCGAGATTGAAGCTGGTGACCATTGGCCTTACTGGGATGCTCTTGTGATTACTACTACTAATCGTTGTGAACGTAAATGC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0846 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-2CGTGATGATGTTGAGTTG-GTGTTAATCCGTGTATGCCATGAGACCGGTAAGTCCTATTTTCGCTCCTGGAATGGTACAAGCTCATGTCAAGATATACTC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0847 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-3CGTGATGATGTTGAGTTG-GGGCAGATCCGTGCACATGATCTTAGCCGTACGTGTTCTGCGGTATAGTCTATTCATACTACCACTTCGCAATGTATATCG-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_0848 288185572017DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX methodAM-4CGTGATGATGTTGAGTTG-GTCGAGTACGGATCACTTGGAGATTGGCCATCGAGCTATTCTGTAATGTGTAATCCTACTACACCTTCGCATCGTTAATGC-CAGTAATGCCAACCAATCT1185'-CGTGATGATGTTGAGTTG-80N-CAGTAATGCCAACCAATCT-3'ssDNAEscherichia Coli (E. Coli) O157:H7Whole cellIdentify aptamers for the detection of E. coli O157 and selectively distinguish the pathogenic strain from other strains.N/A10Flow CytometryN/ADetectionWhole Cell-SELEXFITC LabeledN/AN/AN/AN/AN/A
ABdb_1815 https://doi.org/10.1016/j.cej.2023.1430992023Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteriaAptamer (AA)AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA118N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 6538)Whole cellDeveloped a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA.Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL.N/AN/AN/ABiosensorN/A5'-FAM Labeled and 3'-ThiolatedN/AN/AN/AN/AN/A