AptBacterialDB

Length : 10 - 20

Total records found: 8

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1214 317045872019Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosisMS10-TruncGGTGGTGGTGG115'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3'ssDNAMycobacterium Tuberculosis (H37Rv)Surface-associated Malate synthase (MS -Whole cells)Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells.Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells.10Surface Plasmon Resonance (SPR)1.9 × 10−11 MTherapeuticsSELEX5'-Biotinylated and 5'-FAM LabeledN/AN/ABest CandidateN/AIndian Patent application no. 201611021901
ABdb_1263 307210472019Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus DeterminationA5AACGAAACAGTGACTCGTT19N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellIdentify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples.N/AN/AFlow Cytometry422.0 ± 21.93 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1264 307210472019Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus DeterminationA6ACGAAACAGTGACTCGT17N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellIdentify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples.N/AN/AFlow Cytometry412.9 ± 27.12 nMBiosensorWhole Cell-SELEX5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1376 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC1TACTTCCGCACCCTCCTACA20N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1380 327852022020Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver NanoclustersNC6ATGAGAGCGTCGGTGTGGTA20N/AssDNAPseudomonas Aeruginosa (ATCC 10145)BiofilmDNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms.Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6.N/AN/AN/ATherapeuticsN/AN/AN/AN/AN/AN/AN/A
ABdb_1863 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterA03CGACTCCGGGAGATCG16N/AssDNAAliarcobacter Butzerli (ATCC 49616)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay19.33 ± 9.76 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1867 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC03CGCTGTCAATCGCG14N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay240.2 ± 106.85 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_1868 376194712024A biosensor encompassing fusarinine C-magnetic nanoparticles and aptamer-red/green carbon dots for dual-channel fluorescent and RGB discrimination of Campylobacter and AliarcobacterC04GCGTCCATGTCGC13N/AssDNACampylobacter Jejuni (ATCC 33560)Whole cellDeveloped a bi-module biosensor using FsC-MNPs and aptamer-CDs to discriminate Campylobacter and Aliarcobacter.N/A12Fluorescence Binding Assay259.8 ± 55.1 nMBiosensorWhole Cell-SELEX with the High-Throughput Sequencing (HTS)5'-FAM LabeledN/AN/AN/AN/AN/A