Determination of affinity method : Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0552	25443790	2015	Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials	fmA12	UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU	40	5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'	ssRNA	Staphylococcus aureus (S. aureus)	Staphylococcus aureus Protein A (SpA)	Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.	fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells.	8	Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)	95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI)	Targeted Delivery/Therapeutics	SELEX	2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)	N/A	76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h.	N/A	~52 h for fmA12.	N/A
ABdb_0555	25443790	2015	Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials	fmG12	UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA	40	5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'	ssRNA	Staphylococcus aureus (S. aureus)	Staphylococcus aureus Protein A (SpA)	Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.	N/A	8	Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)	475 nM (by SPR) and 220 ± 24 nM (by BLI)	Targeted Delivery/Therapeutics	SELEX	2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A