AptBacterialDB

Determination of affinity method : Ribogreen dye-based fluorescence intensity assay

Total records found: 5

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0628 258413812015Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralizationABA1UUCAGGGACCAGUGUUUGCCUUGUGCCAGUC315'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3'ssRNABacillus Anthracis (BA)Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain)Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin.IC50 value is higher than 15 μM.8Ribogreen dye-based fluorescence intensity assay108 ± 33.4 nMTherapeuticsSELEXN/AN/AN/AN/AN/AN/A
ABdb_0629 258413812015Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralizationABA2CCCAUAGUGAGUCGUAUUAAUUG235'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3'ssRNABacillus Anthracis (BA)Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain)Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin.IC50 value is higher than 15 μM.8Ribogreen dye-based fluorescence intensity assay296 ± 57.1 nMTherapeuticsSELEXN/AN/AN/AN/AN/AN/A
ABdb_0630 258413812015Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralizationABA3GCGACCCUAUAGUGAGUCGUAUUAAUGCGC305'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3'ssRNABacillus Anthracis (BA)Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain)Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin.IC50 value is higher than 15 μM.8Ribogreen dye-based fluorescence intensity assay388 ± 79.2 nMTherapeuticsSELEXN/AN/AN/AN/AN/AN/A
ABdb_0631 258413812015Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralizationABA4GCGCCCCUAUAUGAGUCGUAUUAAUUGCGC305'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3'ssRNABacillus Anthracis (BA)Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain)Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin.IC50 value is higher than 15 μM.8Ribogreen dye-based fluorescence intensity assay105 ± 10.9 nMTherapeuticsSELEXN/AN/AN/AN/AN/AN/A
ABdb_0632 258413812015Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralizationABA5GCGCCCCCAUAGUGAGUCGUAUUAAUACGC305'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3'ssRNABacillus Anthracis (BA)Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain)Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin.ABA 5 rescued cells to at least 50% maximum cell viability, with an IC50 value of 5 μM.8Ribogreen dye-based fluorescence intensity assay205 ± 69.8 nMTherapeuticsSELEXN/AN/AN/AN/AN/AN/A