Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 591
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0025 | 17265180 | 2007 | Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores | Aptamer | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | 60 | N/A | ssDNA | Bacillus Thuringiensis (BT) | BT spores | Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores. | Limit of detection (LOD) between 10³ and 10(4) CFU. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0048 | 18214875 | 2008 | Detection and titer estimation of Escherichia coli using aptamer-functionalized single-walled carbon-nanotube field-effect transistors | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop aptamer-functionalized SWNT-FET sensors for the detection of E. coli. | The SWNT-FETs showed a conductance decrease of more than 50% after binding with E. coli in less than 20 min. | N/A | N/A | N/A | Detection | SELEX | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0065 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | M64CA (aptamers 20, 34, 41, 46, and 50 ) | GGGAGCTCAGAATAAACGCTCAA-TTCGGGAATGATTATCAAATTTATGCCCTCTGAT-TTCGACATGAGGCCCGGATC | 77 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0066 | 19284297 | 2009 | The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis | Aptamer 11 (named M64RA) | GGGAGCTCAGAATAAACGCTCAA-TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Identify an aptamer that binds to MPT64, and an aptamer-MPT64 was designed to detect M. tuberculosis by measuring MPT64 protein levels in culture filtrates. | The sandwich assay scheme based on the aptamer-protein complex had a high sensitivity (86.3%) and specificity (88.5%). | 12 | N/A | N/A | Detection | SELEX | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0072 | 19569156 | 2009 | Immediate detection of living bacteria at ultralow concentrations using a carbon nanotube based potentiometric aptasensor | Aptamer | GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC | 71 | N/A | ssRNA | Salmonella Typhi (CECT 409) | Type IVB Pili structural proteins | Develop a potentiometric biosensor using an aptamer-SWCNT for selectively detecting a single CFU of ST in close to real time. | Display detection range from 0.2 CFU/mL (1 CFU in 5 mL PBS) to 10(6) CFU/mL within 60sec. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation ((CH2)5-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0073 | 19505816 | 2009 | A sensitive method to detect Escherichia coli based on immunomagnetic separation and real-time PCR amplification of aptamers | E. coli specific RNA aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Develop an aptamer-based, antibody-conjugated magnetic-bead sandwich assay to detect E. coli. | Showed a wide dynamic range from 10¹ to 10(7) E. coli per ml and achieved a detection limit of 10 E. coli in a 1 ml sample. | N/A | N/A | N/A | Biosensor | N/A | 2'-Fluoro pyrimidines (2'-F-RNA) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0074 | 19234874 | 2009 | Aptamer-based electrochemical biosensor for Botulinum neurotoxin | BoNT/A aptamer | ATACCAGCTTATTCAATTGACATGACTGGGATTTTTGGCGAAATCGAAGGAAGCGGAGAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) toxoid | Developed an aptamer-based electrochemical sensor for the detection of Botulinum neurotoxin. | Achieved a limit of detection (LOD) of 40 pg/ml within 24 h. | N/A | N/A | 3.0 ± 0.8 × 10(9) M−1 | Biosensor | Single micro-bead SELEX | 5'-Biotinylated and 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0078 | 20337767 | 2010 | Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from food | A8 | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (F4244) | Internalin A (InlA) | Antibody-aptamer functionalized fibre‐optic biosensor for specific detection of Listeria monocytogenes from food products. | The detection limit of this sensor was 1 × 10(3) CFU/ml, and it could successfully detect a lower inoculum size of 10(2) CFU/25g. | N/A | N/A | N/A | Biosensor | N/A | AlexaFluor 647 Labeled or Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0079 | 20961052 | 2010 | Real-time potentiometric detection of bacteria in complex samples | Aptamer | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) CECT 675 cells | Whole cell | Potentiometric aptamer-based biosensor to detect E. coli CECT 675 as a nonpathogenic surrogate for pathogenic E. coli O157:H7 in complex liquid samples. | Display LOD of 10(4) CFU/mL with a linear range from 4 to ∼10(4) CFU/mL. The lowest bacterial count detected in complex matrices was 12 CFU in 2 mL of milk (6 CFU/mL) and 26 CFU in 1 mL of apple juice. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation ((CH2)5-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0083 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence A | GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT | 76 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0084 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence B | CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC | 149 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0123 | 21875107 | 2011 | Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction | Sal aptamer | CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC | 86 | 5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples. | Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0134 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6F | ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0135 | 22218972 | 2012 | Development of aptamer beacons for rapid presumptive detection of Bacillus spores | BAS-6R | ATCCGTCACACCTGCTCT-GCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGGA-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Bacillus Anthracis (BA) (nonpathogenic Sterne strain) | Anthrose and Whole B. anthracis spores | Aptamer beacon that specifically binds to the Bacillus spores. | Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-TYE 665 dye and 3'-Iowa Black end labels | N/A | N/A | N/A | N/A | N/A |
| ABdb_0136 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0137 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A2 | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0139 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | NH2-Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0140 | 22154169 | 2012 | Label-free detection of Staphylococcus aureus in skin using real-time potentiometric biosensors based on carbon nanotubes and aptamers | Pyr-Aptamer | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A single-walled carbon nanotube (SWCNT) functionalized with an aptamer-based biosensor to detect Staphylococcus aureus in real-time. | With covalent functionalization, the minimum concentration detected was 8 × 10(2) CFU/mL; with the non-covalent approach, it was 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0141 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0143 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-72 | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0144 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0145 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-72 | ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGGAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0146 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0186 | https://doi.org/10.1002/elan.201100700 | 2012 | A Rapid and Sensitive Aptamer-Based Electrochemical Biosensor for Direct Detection of Escherichia Coli O111 | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O111 | Lipopolysaccharide (LPS) | Developed an electrochemical biosensor based on target-induced aptamer displacement for the detection of E. coli O111. | Achieved a detection limit of 112 CFU/mL in PBS and 305 CFU/mL in milk within 3.5 hours. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0187 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-1 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0188 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-2 | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0189 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-3 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0190 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-4 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0191 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-5 | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0192 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-6 | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0193 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-7 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0194 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-8 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0195 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-9 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | Can successfully detect S. enteritidis down to 600 CFU/mL (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-6-hydroxyhexyl disulfide group (5'-/5ThioMC6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0196 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-10 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0321 | https:doi.org10.1007s13765-013-3019-7 | 2013 | Potential of fluorophore labeled aptamers for Pseudomonas aeruginosa detection in drinking water | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | Develop a fluorophore-labelled aptamer to detect P. aeruginosa in drinking water. | The limit of detection for P. aeruginosa was 5.07 cells/mL, with a linear dynamic range of 5.64 to 100 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0333 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A1 | GGGAACAGUCCGAGCCUCACUGUUAUCCGAUAGCAGCGCGGGAUGAGGGUCAAUGCGUCAUAGGAUCCCGC | 71 | N/A | ssRNA | Salmonella Typhi (CECT 409) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 0.2 CFU/mL (1 CFU in 5 mL PBS) to 10(6) CFU/mL of ST and LOD of 0.2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0334 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A2 | GGGAGAGCGGAAGCGUGCUGGGUCGCAGUUUGCGCGCGUUCCAAGUUCUCUCAUCACGGAAUACAUAACCCAGAGGUCGAU | 81 | N/A | ssRNA | Escherichia Coli (E. Coli) (CECT 675) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 4 to 10(4) CFU/mL and LOD of 4 CFU/mL, and the signal was stable after 120 s. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0335 | 23872060 | 2013 | Carbon nanotube-based aptasensors for the rapid and ultrasensitive detection of bacteria | A3 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Type IVB Pili structural proteins | Develop a potentiometric biosensor based on carbon nanotubes (transducer layer) and aptamers (sensing layer) for the detection of bacteria. | Display linear range from 8 × 10(2) CFU/mL–10(8) CFU/mL with LOD of 8 x10(2) CFU/mL and the signal was stable for at least one hour. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0338 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | L. acidophilus (FALA) | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Lactobacillum Acidophilius (ATCC 4356) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 11.0 cfu/mL (L. acidophilus). | N/A | N/A | 13 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0339 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. aureus (FASA) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL. | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0340 | 23929394 | 2013 | A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection | S. enterica (FASE) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection. | Detection limits (LOD) of 61.0 cfu/mL (S. enterica) and linear ranges of 42.2–675.0 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0341 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA I | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGC | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0342 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA II | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0413 | 24445115 | 2014 | An aptamer-based electrochemical biosensor for the detection of Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Aptamer-based electrochemical biosensor for Salmonella detection. | A detection limit of 3 cfu/mL was achieved, with a linear range of 2.4 cfu/mL to 2.4 × 10^3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0414 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA20 | GCAATGGTACGGTACTTCCGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTATCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0415 | 24325983 | 2014 | Graphene-based potentiometric biosensor for the immediate detection of living bacteria | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CECT 4630) | Whole cell | Developed a potentiometric aptasensor based on graphene oxide (GO-covalently conjugated aptamer) and reduced graphene oxide (RGO-non-covalently conjugated aptamer) to detect S. aureus. | Able to detect 1 CFU/mL in a few minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-C3-Pyr | N/A | N/A | N/A | N/A | N/A |
| ABdb_0416 | 24804556 | 2014 | Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop aptamer recognition and FSiNPs label-based dual-colour flow cytometry assay (Aptamer/FSiNPs-DCFCM) for the detection of S. aureus. | Detects as low as 1.5×10(2) and 7.6×10(2) cells/mL S. aureus in buffer and spiked milk, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0417 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT17 | CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0418 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT12 | CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0419 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT11 | CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0420 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT9 | CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0421 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT8 | CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0422 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT7 | CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0423 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT6 | CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0424 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5 | CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0425 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5.1 | CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0426 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT4 | CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0427 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 12.4 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0428 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 25.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0429 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 14.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0430 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₁ | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0431 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₂ | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0432 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₃ | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0433 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | ST-apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A universal fluorescent aptasensor based on the AccuBlue dye was developed for the detection of pathogenic bacteria. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 25 cfu/mL in 1.5 h for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0434 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | VP-apt | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer is hybridized with complementary DNA (cDNA) to form fluorescent dsDNA. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 35 cfu/mL in 1.5 h for V. parahaemolyticus. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0445 | 25220163 | 2014 | Potentiometric Aptasensing of Listeria monocytogenes Using Protamine as an Indicator | LM aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Internalin A (InlA) | Develop a label-free potentiometric aptasensor for selective detection of L. monocytogenes. | LM can be detected down to 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0454 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0455 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0456 | https://doi.org/10.1007/s00604-014-1170-4 | 2014 | Fluorescent aptasensor for the determination of Salmonella typhimurium based on a graphene oxide platform | Aptamer | GGGAGCTCAGAATAAACGCTCAAGGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTGTTCGACATGAGGCCCGGAC | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Developed a fluorescent aptasensor based on a graphene oxide platform for the determination of S. typhimurium. | Displays a linear response to bacteria in the concentration range from 1 × 10(3) to 1 × 10(8) CFU/mL, with a detection limit of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0457 | 24913871 | 2014 | A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology. | Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0459 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 3R | CACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich (EcO 3R/4F) Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3′-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0460 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 4F | ATACGGGAGCCAACACCATAATATGCCGTAAGGAGAGGCCTGTTGGGAGCGCCGTAGAGCAGGTGTGACGGAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0461 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt1 ( V. parahaemolyticus aptamer) | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0462 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt2 (S. typhimurium aptamer) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 14028) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 35 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0466 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0467 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Amplify-aptamer (a-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0499 | 24287407 | 2014 | Aptamer biosensor for sensitive detection of toxin A of Clostridium difficile using gold nanoparticles synthesized by Bacillus stearothermophilus | Aptamer | TAGTGATGCCTTTGTTGAGA-AGACTTGGGGGCAGGGTCGTGAGGACGTACGTGCGAGTGT-TCTTCATCGTCCACTAAATT | 80 | 5'-TAGTGATGCCTTTGTTGAGA-N40-TCTTCATCGTCCACTAAATT-3' | ssDNA | Clostridium Difficile | Toxin A (TOA) | Developed an electrochemical biosensor to detect TOA based on Nafion-thionine-GNPS-modified screen-printed electrode (SPE). | Shows a linear range of 0–200 ng/mL with the detection limit of 1 nM for TOA. | N/A | N/A | N/A | Biosensor | N/A | 5'-FITC Labeled | N/A | 87.6% of its original response remaining after storage for 2 weeks at 4°C in PBS (pH 7.0). | N/A | N/A | N/A |
| ABdb_0500 | 25016253 | 2014 | Evanescent wave DNA-aptamer biosensor based on long period gratings for the specific recognition of E. coli outer membrane proteins | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | A label-free remote evanescent wave fibre optic sensor using long-period gratings (LPGs) was developed for the detection of EcOMPs. | Displayed linear responses in the range of 0.1 nM to 10 nM EcOMPs and LOD of 10 nM in less than 1 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0501 | https://doi.org/10.1039/C4RA01901F | 2014 | A simple aptamer biosensor for Salmonellae enteritidis based on fluorescence-switch signaling graphene oxide | S-aptamer | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) (ATCC 13076) | Whole cell | Developed a fluorescent aptasensor with an aptamer functionalized into graphene oxide to detect S. enteritidis. | Can detect as low as 40 CFU/mL of S. enteritidis in 30 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0540 | 25891472 | 2015 | Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogen | SA20hp | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin. | 15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1 | MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL. | N/A | N/A | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0657 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.02 | TGTACCGTCTGAGCGATTCGTAC-TACGCCACACGTGGTGAGGGATTCGATCGCTTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0658 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.20 | TGTACCGTCTGAGCGATTCGTAC-TGCTATTCATCACCACTCTAGAGCCACTTTTAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0659 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.22 | TGTACCGTCTGAGCGATTCGTAC-TGGGCGGCGAGCCACCCGGCAATTTAGTACAGGC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0660 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.36 | TGTACCGTCTGAGCGATTCGTAC-AAAGCATCCAGCCGGTATGTGCCAGAGTCTCTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0661 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.38 | TGTACCGTCTGAGCGATTCGTAC-AAATGTGAGTGGCCAGGCATCAGGTACGTCGGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0662 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.03 | TGTACCGTCTGAGCGATTCGTAC-GGATAGGTGCCTCTGCTTCATCATGTTGAACTTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0663 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.13 | TGTACCGTCTGAGCGATTCGTAC-AGTTTCACCAGTCGCCTGTTAGCCGTGATATACG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0664 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.27 | TGTACCGTCTGAGCGATTCGTAC-TGTCAATATTACGTTGCTCTTAGGTTCACCATCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0665 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.28 | TGTACCGTCTGAGCGATTCGTAC-TTGTGATTCAAATAGGCGTGTTGGTGTGAGACCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0666 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.23 | TGTACCGTCTGAGCGATTCGTAC-CGTGGATCATGCTTCGCGTCGGTTTATAGGTTCC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0667 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.39 | TGTACCGTCTGAGCGATTCGTAC-AGAAGAGCATCGGTAACTTCCATAGGAGATGGGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0668 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.06 | TGTACCGTCTGAGCGATTCGTAC-CATCCGAGGGTATTGTATGCGTATATCCTAGTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0669 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.10 | TGTACCGTCTGAGCGATTCGTAC-CAAGTTCCTCATGGAGGGTGCTCAGAGCTTAGAC-AGCCAGTCAGTGTTAAGGAGTAA | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0670 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.34 | TGTACCGTCTGAGCGATTCGTAC-AGGGGGATTCCTAGGGCCCGGCCCAACGCTGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0671 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.42 | TGTACCGTCTGAGCGATTCGTAC-CAAGACCCTTGAATCACGGGTAGGGTCTCGTAAC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0672 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Lac-apt | AGCAGCACAGAGGTCAGATGTAGCCCTTCAACATAGTAATATCTCTGCATTCTGTGTGCCTATGCGTGCTACCGTGAA | 78 | N/A | ssDNA | Lactobacillus Acidophilus (KCTC 3164) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | 13 ± 3 nM | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0673 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Sty-apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0674 | 25476286 | 2015 | Aptamer-functionalized localized surface plasmon resonance sensor for the multiplexed detection of different bacterial species | Pae-apt | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | The aptamer-immobilized LSPR sensor was developed for bacteria detection. | Showed a detection limit of 30 cfu per assay. | N/A | N/A | 17.27 ± 5 nM | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0675 | https://doi.org/10.1007/s00604-015-1649-7 | 2015 | Impedimetric Salmonella aptasensor using a glassy carbon electrode modified with an electrodeposited composite consisting of reduced graphene oxide and carbon nanotubes | Anti-Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Develop a label-free impedimetric aptasensor based on an amino-modified aptamer bound to rGO-MWCNT composite for the detection of Salmonella. | Exhibits a linear range from 75 to 7.5 × 10(5) cfu/mL and a detection limit of 25 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0692 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0693 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 2 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0694 | 25702275 | 2015 | A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification | Amplification-aptamer (a-aptamer) | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGT | 49 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Outer membrane protein (OMP) | Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli. | Can detect as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0695 | 25702275 | 2015 | A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Outer membrane protein (OMP) | Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli. | Can detect as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0699 | 25461175 | 2015 | A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed an aptamer/graphene interdigitated gold electrode piezoelectric sensor to detect Staphylococcus aureus. | Achieved a detection limit of 41 cfu/mL with a linear range of 4.1×10(1) to 4.1×10(5) cfu/mL. The detection is rapid, completing in less than 60 minutes. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0700 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0701 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 35 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0703 | https://doi.org/10.1080/00032719.2015.1036278 | 2015 | Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop an aptamer-based magnetoelastic sensor for the detection of S. aureus. | Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0704 | https://doi.org/10.1039/C4AY02880E | 2015 | Rapid and sensitive detection of Salmonella typhimurium using aptamer-conjugated carbon dots as fluorescence probe | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a fluorescence probe based on amino-modified aptamer conjugated to carboxyl-modified carbon dots (CDs) for detection of Salmonella typhimurium. | Limit of Detection (LOD): 50 cfu mL⁻¹ and linear range of 10(3)-10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0705 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 4 Rev | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0706 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 3 Rev | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | Exhibited a linear range of 10-10(4) cfu/mL and the detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0707 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0708 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0712 | https://doi.org/10.1080/00032719.2015.1052974 | 2015 | Determination of Shigella flexneri by a Novel Fluorescent Aptasensor | Aptamer1 | CCTCATGTCGAACAGCAACACTGCAACACTGTATAGTCCTGTGTGCCTTGAGCGTTTATTCTGAGCT | 67 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed a homogeneous fluorescent aptasensor using a dye-labelled aptamer and graphene oxide, using target recycling amplification for Shigella flexneri detection. | A linear relationship was displayed from 500 to 10(9) CFU/mL with a limit of detection of 100 CFU/mL. | N/A | N/A | 29 ± 4 nM | Biosensor | N/A | Carboxyfluorescein-GGGCCC at the 5' and 3' ends | N/A | N/A | N/A | N/A | N/A |
| ABdb_0722 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 10 | GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG | 44 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0723 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 22 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG | 41 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0724 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 45 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC | 40 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0725 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 60 | CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG | 37 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0726 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 1 | CGAAGGGGCTATGCCGCCTACATAGACCGTCACGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0727 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 2 | GGCCGGCAATACGGCCGAGCCCGGGGTTCCTCCGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0728 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 3 | GCCACGCGCAGCAATCAAACCCGGCCCCCTGCTCC | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0729 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 4 | TGGCCAGAGTACGAGTAAGGGAGGTCACAACCTTA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0730 | 27424215 | 2016 | Gold nanoparticle-DNA aptamer conjugate-assisted delivery of antimicrobial peptide effectively eliminates intracellular Salmonella enterica serovar Typhimurium | AptHis (6H7) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Salmonella typhimurium infected HeLa cells | S. typhimurium Whole cell | His-aptamer conjugated AuNP platform for the loading of His-tagged AMP (C-terminally hexahistidine-tagged A3-APO (A3-APOHis) AMPs) to eliminate intracellular S. Typhimurium cells. | 80% viability increase of infected HeLa cells and 100% survival rate of infected mice. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) and Cyanine5 (Cy5) Labeled | AuNP-Apt(His)-A3-APO(His) led to the increased viability of S. Typhimurium-infected HeLa cells. | ∼80% of A3-APOHis remained in serum after 48 h of incubation with AuNP-Apt(His)-A3-APO(His). | N/A | N/A | N/A |
| ABdb_0760 | https:doi.org10.1016j.carbon.2016.04.014 | 2016 | Biodegradable graphene oxide and polyaptamer DNA hybrid hydrogels for implantable drug delivery | Polyaptamer (PA) | ATCGGCTAGCACGTACAGAACTAAAAAAAAAAAA-GTCGGCTTAGCCTCAACCCCC-AAGGCAAAAAGGCAT | 70 | N/A | ssDNA | Escherichia Coli (E. Coli) and Staphylococcus aureus (S. aureus) | Kanamycin (Kan) | Kan-loaded PA-GO (Kan/PA-GO) hybrid hydrogels for antibacterial effects. | Significantly reduced the viability of E. coli and S. aureus to 24.2 ± 4.8% and 17.7 ± 0.7%, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Phosphate | N/A | N/A | N/A | N/A | N/A |
| ABdb_0789 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0790 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0791 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA3 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Pacific Blue | N/A | N/A | N/A | N/A | N/A |
| ABdb_0792 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA4 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0793 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA5 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0794 | 26592593 | 2016 | Chemiluminescent aptasensor capable of rapidly quantifying Escherichia Coli O157:H7 | EA6 | GGGGGGTTTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Develop aptamer conjugated graphene oxide (GO)/iron nanocomposites for guanine chemiluminescence detection of E. Coli O157:H7. | The limit of detection (LOD) was as low as 4.5×10(3) cfu/ml, with a linear range of 10(4)-10(7) cfu/ml. | N/A | N/A | N/A | Biosensor | N/A | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0795 | 26334590 | 2016 | Label-free and highly sensitive electrochemical detection of E. coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification | Anti-E. coli aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Label-free electrochemical biosensor using RCA coupled DNAzyme amplification for detecting E. coli. | Exhibits detection limits of 8 cfu/mL and a detection range of 5 orders of magnitude. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0805 | 27318566 | 2016 | Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus. | Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0806 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0807 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-X-rhodamine (ROX) modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0808 | 26894987 | 2016 | Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample | Aptamer (N45) | TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT | 96 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | Developed a label-free impedimetric aptamer-based biosensor for S. typhimurium detection. | Rapid (30 min) detection with a concentration range of 1×10(1) to 1×10(8) CFU/mL and limit of detection (LOD) of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0809 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-S. aureus | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) and 3'-FAM Labeled ((CH2)7-FAM) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0810 | 27411775 | 2016 | Rapid and Selective Detection of Pathogenic Bacteria in Bloodstream Infections with Aptamer-Based Recognition | Apt-E. coli | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Aptamer-based capture platform using Fe3O4@mTiO2 magnetic nanoparticles for the detection of bacteria. | Display a favourable bacterial-capture efficiency of about 80% even at low infectious doses (10–2000 CFU/mL). | N/A | N/A | N/A | Detection | N/A | 3'-Amidation (NH₂-(CH2)7) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0811 | 27404735 | 2016 | Highly sensitive detection of lipopolysaccharides using an aptasensor based on hybridization chain reaction | Detection probe | GTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGA | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptasensor assay based on hybridization chain reaction (HCR) to detect LPS. | Display a relatively low detection limit (1.73 ng/mL) with a linear response range of 1–10(5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0812 | 26641108 | 2016 | Dual Recognition Strategy for Specific and Sensitive Detection of Bacteria Using Aptamer-Coated Magnetic Beads and Antibiotic-Capped Gold Nanoclusters | SA-aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-coated magnetic beads (Apt-MB) and Van-functionalized fluorescent gold nanoclusters (AuNCs@Van) were employed for specific capture of SA. | Sensitive quantification of SA in the range of 32–10(8) cfu/mL with the detection limit of 16 cfu/mL via fluorescence intensity. | N/A | N/A | N/A | Biosensor | N/A | 5′-Biotinylated and 5′-Cyanine3 (Cy3) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0813 | 27427591 | 2016 | Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles | SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Develop an aptamer-AuNPs-based colorimetric method for duplex identification of S. aureus. | AuNPs as a sensor could well distinguish S. aureus from S. enteritidis and P. mirabilis. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0817 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 16 cfu/mL (S. aureus). | N/A | N/A | 35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0818 | 26971274 | 2016 | Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Dual-excitation aptasensing platform based on the luminescent nanoparticles (QDs and UCNPs) for the detection of Salmonella typhimurium and Staphylococcus aureus. | Linear detection range: 50 to 10⁶ cfu/mL; LOD: 28 cfu/mL (S. typhimurium). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0819 | 27209574 | 2016 | A paper based graphene-nanocauliflower hybrid composite for point of care biosensing | RNA Aptamer | GGGUCUUCCUGGACUGUCGAAAAUUCAGUAUCGGGAGGUUACGUAUUUGGUUUAUAGAUAGUAA | 64 | N/A | ssRNA | Escherichia Coli (E. Coli) O157:H7(ATCC 43895) | O-antigen | Develop electrochemical biosensing platform using graphene paper functionalized with fractal platinum nanocauliflower for detection of E. coli O157:H7. | Detection limit (LOD) of ~4 CFU/mL with linear range of 4 to 10(5) CFU/mL and a response time of 12 min. | N/A | N/A | 110 nM | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0820 | https://doi.org/10.1021/acssensors.6b00333 | 2016 | Quantitative Label-Free Listeria Analysis Based On Aptamer Modified Nanoporous Sensor | LM Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed a nanoporous sensor with aptamer combined porous anodic aluminium oxide membrane for detection of L. monocytogenes. | Achieved detection within 10 min, with a high sensitivity of 100 CFU/mL and a good linear range between 100 and 1250 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-CHO | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0822 | https://doi.org/10.1039/C6AY02623K | 2016 | SERS aptasensor detection of Salmonella typhimurium using a magnetic gold nanoparticle and gold nanoparticle based sandwich structure | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a SERS aptasensor using aptamer-functionalized magnetic gold nanoparticles (MGNPs) and mercaptobenzoic acid (4-MBA) functionalized gold nanoparticles (GNPs) based sandwich structure for the detection of S. typhimurium. | Exhibit a good linear range from 10 cfu/mL to 10(7) cfu/mL, and the LOD is 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0832 | 28206680 | 2017 | A single-stranded DNA aptamer against mannose-capped lipoarabinomannan enhances anti-tuberculosis activity of macrophages through downregulation of lipid-sensing nuclear receptor peroxisome proliferator-activated receptor γ expression | ZXL1 | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Downregulate PPARγ expression by blocking the binding of ManLAM to MR on macrophages, and ZXL1 enhances IL-1β and IL-12 mRNA expression and cytokine production in ManLAM-treated macrophages but decreases IL-10 production. | The percentage of macrophages that took up iH37Rv decreased from 15.9% to 7.2%, thereby inhibiting ManLAM-induced immunosuppression of DCs. | N/A | N/A | N/A | Therapeutics/Immunmodulatory | N/A | Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0833 | 28778062 | 2017 | DNA aptamer functionalized gold nanostructures for molecular recognition and photothermal inactivation of methicillin-Resistant Staphylococcus aureus | Aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) standard strain 43300 | Whole cell | Aptamer-functionalized gold nanorods (Apt@Au NRs) for inactivation of MRSA with targeted photothermal therapy (PTT). | Over 95% inactivation of MRSA cells within 2 min. | N/A | N/A | N/A | Therapeutics | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0932 | 27696554 | 2017 | Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | ELAA and ITC to study impact of temperature and ion concentration in the binding of aptamer to its target on surface of bacteria. | Both temperature and salt concentration directly influenced the 3D structure of the DNA molecule under specified experimental conditions, thereby altering the aptamer's affinity for its target. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0934 | 27825886 | 2017 | Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detection | E.coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Upconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk. | Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0947 | 28551117 | 2017 | Electrochemical determination of M. tuberculosis antigen based on Poly(3,4-ethylenedioxythiophene) and functionalized carbon nanotubes hybrid platform | MPT64 aptamer | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor based on MWCNT-doped PEDOT nano-composite for the detection of Mycobacterium tuberculosis. | Exhibits a LOD of 0.5 fg/mL within 15 min for the detection of M. tb antigenic protein with recovery in between (88–95)%. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The stability of the aptasensor is 27 days at 4°C, and the reusability is 7 times after repeated regeneration with 50 mM NaOH. | N/A | N/A | N/A |
| ABdb_0948 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0949 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0950 | https://doi.org/10.1007/s00604-017-2142-2 | 2017 | A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples. | Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0951 | https://doi.org/10.1016/j.snb.2017.09.121 | 2017 | Novel impedimetric aptasensor for label-free detection of Escherichia coli O157:H7 | E. coli specific aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a novel impedance-based aptasensor for the detection of E. coli O157:H7. | Exhibited a broad range from 10(1) to 10(5) cfu/mL with the LOD about 2.9 × 10(2) cfu/mL with a detection time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-disulfide-modified | N/A | N/A | N/A | N/A | N/A |
| ABdb_0952 | https://doi.org/10.1016/j.foodcont.2017.07.016 | 2017 | SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a novel SGNPs-based SERS aptasensor functionalized with p-MBA for the detection of S. typhimurium. | Display linear range 10(1) cfu/mL to 10(5) cfu/mL, with a limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated or Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0954 | 29051620 | 2017 | Antimicrobial peptide-loaded gold nanoparticle-DNA aptamer conjugates as highly effective antibacterial therapeutics against Vibrio vulnificus | Apt(His) | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | 40 | N/A | ssDNA | Vibrio Vulnificus (MO6-24/O) | V. vulnificus-infected HeLa cells | The AuNP-AptHis conjugate delivers the HPA3P(His) peptide into host cells, inducing bacterial cell death by disrupting membrane integrity. | Compared with that of buffer- or AuNP-AptHis-incubated cells, the number of viable V. vulnificus cells in the AuNP-AptHis-HPA3PHis-treated cells decreased by 90% in 10 min. All infected mice injected with AuNP-AptHis-HPA3PHis survived until 120 h. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Thiolated (A10-Thiol) | HPA3PHis and AuNP-Apt(His)-HPA3P(His) did not exhibit cytotoxicity against HeLa cells and mouse erythrocytes up to 10 µM. | N/A | N/A | N/A | N/A |
| ABdb_0955 | 29071202 | 2017 | An Electrochemical Aptasensor Using Coaxial Capillary with Magnetic Nanoparticle, Urease Catalysis and PCB Electrode for Rapid and Sensitive Detection of Escherichia coli O157:H7 | E. coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Develop an electrochemical aptasensor for rapid and sensitive detection of E. coli O157:H7 that relies on aptamer and urease-modified GNPs. | Able to detect E. coli as low as 10(1) CFU/mL in 3 h, and the mean recovery of E. coli in the spiked pasteurized milk was ~99%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0956 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | S.aureus-AptamerS | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | Exhibited a linear concentration, ranging from 10(1) to 10(7) cfu/mL with the detection limit of 1.5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0957 | 28803475 | 2017 | Intuitive Label-Free SERS Detection of Bacteria Using Aptamer-Based in Situ Silver Nanoparticles Synthesis | L.mono-AptamerL | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21633) | Whole cell | Developed a SERS-based aptasensor using aptamer@AgNPs for the detection of bacteria. | N/A | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0958 | 28107686 | 2017 | A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Colorimetric aptasensor was developed based on color changing GNPs for the detection of S. typhimurium. | Quantitative detection of S. typhimurium from 10(2) to 10(7) cfu/mL with a detection limit as low as 56 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0959 | 28107930 | 2017 | A chemiluminescent aptasensor based on rolling circle amplification and Co2+/N-(aminobutyl)-N-(ethylisoluminol) functional flowerlike gold nanoparticles for Salmonella typhimurium detection | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Chemiluminescent aptasensor based on rolling circle amplification (RCA) using Co2+/ABEI-AuNFs-cDNA complex was developed for the detection of S. typhimurium. | The limit of detection (LOD) was 10 cfu/mL. The method exhibited excellent selectivity over non-target bacteria. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated (Biotin-TTTTTT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0960 | 29030671 | 2017 | Graphene-based label-free electrochemical aptasensor for rapid and sensitive detection of foodborne pathogen | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | rGO-azophloxine (AP) nanocomposite aptasensor was developed for the detection of foodborne pathogens. | Exhibited a linear range of detection from 10(8) to 10(1) cfu/mL with a detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Aptasensor showed good stability for up to 20 days, with a 5.1% increase in current response when stored in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_0961 | 28645756 | 2017 | An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkey | S. Typhimurium aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based PCR method coupled with magnetic immunoseparation was developed to detect S. Typhimurium from ground turkey. | Able to detect 10(2) CFU/mL of S. Typhimurium in pure culture, and 10(3) CFU/mL of S. Typhimurium in ground turkey. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0964 | 28987879 | 2017 | Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in mice | CD44 Thioaptamer (CD44TA) | GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC | 74 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CD44 receptor (Mtb-infected murine macrophages) | Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs. | CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control. | N/A | N/A | N/A | Therapeutics | N/A | *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled | In uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability. | N/A | N/A | N/A | N/A |
| ABdb_0965 | 28287715 | 2017 | Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles | Aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Bacterial cell wall | Develop a dual-molecular FRET platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively, for the detection of pathogenic bacteria. | Shows a linear concentration of Staph. aureus in the range from 20 to 10(8) cfu/mL with a detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0966 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Direct Dot-Blot Aptamer | GGCGCCATAGCGACGGGGCCATTCCAAGAA | 30 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The direct dot-blot system provided a lower limit of quantitation of 10(4) CFU/mL and greater accuracy. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0967 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Indirect Dot-Blot Aptamer | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The limit of quantitation (LOQ) for indirect assays was 10(5) CFU/mL. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0968 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA1 | TCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCT | 57 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0969 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 2 | TCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCT | 61 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0970 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 3 | TCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCT | 65 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | The sensor has a linear calibration range of 1-150 ng/mL and a detection limit of 50 pg/mL, quantitatively, with the portable spectrophotometer, and 20 ng/mL, semi-quantitatively, with the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0971 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 4 | TCTCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCTCT | 69 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0972 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 1 (Capture) | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | The limit of detection (LOD) of 11 cfu/mL, and the detection range was 11 to 1.10 × 10(5) cfu/mL of S. typhimurium in buffer solution. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0973 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 2 (Signal) | AAAAAAAAAAAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | Limit of detection (LOD) of 11 cfu/mL | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (12A) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0974 | 27951452 | 2017 | (1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection | Seq6 | CGACTGACGCCTCCAAGCCACACGTGTGAGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCGTCATTCCTTTGTCTGCATGCATCGCTACGTG | 94 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | (1 → 3)-β-D-glucans | Radiolabeled aptamers were evaluated to identify infectious foci caused by bacterial cells. | The target/non-target ratios were 3.17 ± 0.22 for seq6 in S. aureus-infected animals. | N/A | N/A | 0.303 ± 0.067 μM | Imaging | N/A | 5'-Radiolabelled (99mTc labeled) | N/A | In vitro stability of seq6 aptamer labelled with 99mTc in the presence of 0.9% saline, plasma, and cysteine excess (molar ratio) was above 84.2 ± 2.9% in all cases at 24hrs. | N/A | N/A | N/A |
| ABdb_0976 | 28860462 | 2017 | Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 2421) | Whole cell | Develop a portable LSPR biosensor-based device on gold nanoparticles (AuNPs) for the detection of Salmonella typhimurium in pork meat samples. | Limit of detection (LOD) of 10(4) cfu/mL in both pure culture and spiked pork samples, and total analysis time of 30-35 minutes. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0977 | 28624620 | 2017 | AgBr nanoparticles/3D nitrogen-doped graphene hydrogel for fabricating all-solid-state luminol-electrochemiluminescence Escherichia coli aptasensors | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a ECL aptasensor based on amine-functionalized E. coli aptamer and luminol/AgBr/3DNGH for the detection of E. coli. | Linear response range from 0.5 to 500 cfu/mL and Limit of Detection (LOD) of 0.17 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | No obvious change was observed for the response of a BSA/aptamer/GA/CHIT/luminol/AgBr/3DNGH/GCE when stored at 4°C for 12 d, indicating an acceptable stability of the aptasensor. | N/A | N/A | N/A |
| ABdb_0978 | 27526340 | 2017 | Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorods | S. typhimurium aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium. | Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0979 | https://doi.org/10.1007/s00604-017-2174-7 | 2017 | Aptamer based voltammetric biosensor for the detection of Mycobacterium tuberculosis antigen MPT64 | Aptamer 3 | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an aptaelectrode based on graphene modified iron-oxide chitosan hybrid (CHIT-IO-GR) nanocomposite film deposited on fluorine tin oxide (FTO) for the detection of the M. tb. specific antigen MPT64. | Exhibited a limit of detection (LOD) of 0.9 fg/mL within 20 min and a linear range from 1.0 × 10(5) fg/mL to 1.0 fg/mL. | 10 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The biosensor retained about 80% of its initial activity after 10 uses and good stability of 17 day. | Best Candidate | N/A | N/A |
| ABdb_0980 | 28691795 | 2017 | Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles. | The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0981 | 28159108 | 2017 | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | A chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet. | The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0982 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-01 | CATATCCGCGTCGCTGCGCTCAGACCCACCACTACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0983 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-02 | CATATCCGTGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0985 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-04 | ATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 39 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0986 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-05 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCCGCCC | 38 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0987 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-06 | GGGCGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0988 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-07 | GGGCGGGGGGTGCTGGGGGAATGGAGTGCTGCGTGCTGCG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0989 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-08 | GGGCGGGGGTGCTGGGAGAATGGAGTGCTGCGTGCTGCAG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0990 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-09 | GGGCAGGTGTGCTGGGGGAATGGAGTGCTGCGTGCTGCGG | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0991 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-10 | AGACCGCAGGTGCACCGGGCGACGTCTCTGGGTGTGGTGA | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0992 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-11 | AGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0994 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-13 | GGACGCGCGTTGGTGGTGGATGGTGTGTTACACGTGTTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0995 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-14 | CGGGGTGGGACCAGTCTTGCGCGGGTGAC | 29 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0996 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-15 | GGACTGGAGTCTAGACCGGGTAGCTGTGGT | 30 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | N/A | 18 | N/A | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0997 | https://doi.org/10.1007/s12161-017-0864-8 | 2017 | Fabricating a Novel Raman Spectroscopy-Based Aptasensor for Rapidly Sensing Salmonella typhimurium | S. typhimurium aptamer (STA) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a surface-enhanced Raman scattering (SERS) based aptasensor with Raman active molecule attached GNRs and cDNA for the detection of Salmonella typhimurium (ST). | Observed linear ST concentration from 56 to 56 × 10(7) cfu/mL with a LOD of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0998 | 28795534 | 2017 | Graphene Field-Effect Transistors for the Sensitive and Selective Detection of Escherichia coli Using Pyrene-Tagged DNA Aptamer | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Developed a biosensing platform using graphene field-effect transistors (APG-FETs) with the aid of pyrene-tagged DNA aptamers for E. coli detection. | Achieve a detection limit of 10(2) CFU/mL for E. coli within 72 s. | N/A | N/A | N/A | Biosensor | N/A | 5'-(pyrene derivate)-TTTT | N/A | N/A | N/A | N/A | N/A |
| ABdb_0999 | https://doi.org/10.1007/s00604-017-2383-0 | 2017 | Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus | Vp-aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus. | Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response. | N/A | N/A | N/A |
| ABdb_1000 | https://doi.org/10.1016/j.jelechem.2017.10.054 | 2017 | Development of an aptasensor using reduced graphene oxide chitosan complex to detect Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-CHI electrochemical aptasensor to detect Salmonella. | Had a wide detection range of 10(1) to 10(6) CFU/mL with a low limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated ((C12)-SH) and 5'-Amidation ((C12)-NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1001 | https://doi.org/10.1016/j.snb.2017.05.146 | 2017 | A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplification | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells. | RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1002 | 29357405 | 2018 | Combat biofilm by bacteriostatic aptamer-functionalized graphene oxide | ST-3 (or ST-33) | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Biofilm | Aptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation. | 93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms. | 12 | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1066 | 29896641 | 2018 | Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop SERS-based aptasensor using DNA-assembled gold nanodimers (AuNDs) for detection of S. typhimurium. | Display a linear range in the 10(2) to 10(7) cfu/mL, and the limit of detection is 35 cfu/mL within 1hr. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1070 | 30243766 | 2018 | Aptamer-based fluorometric assay for direct identification of methicillin-resistant Staphylococcus aureus from clinical samples | M23 | CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTCCTTAGTCTCCGTCGTCGGCTGCCTCTACAT | 96 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus strain N315 (MRSA) | Penicillin binding protein 2a (PBP2a) | Aptamer-based fluorometric assay for detection of MRSA in clinical samples coupled with immunomagnetic separation. | Exhibited a detection limit of 2.63 × 10(3) and 1.38 × 10(3) CFU/mL in PBS and spiked nasal swab, respectively, within 2 h. | N/A | N/A | 21.9 nM | Biosensor | N/A | 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1071 | 29766180 | 2018 | A nitrocellulose membrane-based integrated microfluidic system for bacterial detection utilizing magnetic-composite membrane microdevices and bacteria-specific aptamers | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A nitrocellulose membrane-based integrated microfluidic system for detecting bacteria. | Display a limit of detection as low as 450 CFU/reaction for AB within 40 minutes and a linear range from 4.5×10(4) to 4.5 CFU/reaction. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1072 | 30014163 | 2018 | Selective capture and sensitive fluorometric determination of Pseudomonas aeruginosa by using aptamer modified magnetic nanoparticles | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | A fluorometric assay for the detection of the food pathogen P. aeruginosa based on hybridization of aptamer and FAM-cDNA (aptamer&FAM-cDNA@MNPs). | Display a linear range between 10 and 10(8) cfu/mL, with a detection limit as low as 1 cfu/mL. The detection process can be finished within <1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1073 | 29260861 | 2018 | Whole-Cell Pseudomonas aeruginosa Localized Surface Plasmon Resonance Aptasensor | Bt-aptamer | ATACCAGCTTATTCAATTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTGAGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | A localized surface plasmon resonance (LSPR) based sensing platform was developed to detect the whole-cell Pseudomonas aeruginosa strain PAO1. | Achieve a limit of detection (LOD) of 10 cfu/mL with a linear range of 10(0)–10(3) cfu/mL. | N/A | N/A | 17.27 ± 5.00 nM | Biosensor | Whole Cell-SELEX | 5′-Biotinylated Polyethene Glycol (Bt-PEG) thiol/PEG thiol (1:3) or 5'-6FAM-aptamer-Biotin-3' | N/A | Stable in ambient conditions for ≥2 months. | N/A | N/A | N/A |
| ABdb_1074 | 30247907 | 2018 | Graphene Oxide Quantum Dots Assisted Construction of Fluorescent Aptasensor for Rapid Detection of Pseudomonas aeruginosa in Food Samples | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Develop a fluorescent aptasensor based on DNA hybridization and fluorescence resonance energy transfer for the detection of P. aeruginosa. | Shows a wide linear range of 1.28 × 10(3)-2.00 × 10(7) cfu/mL with a detection limit of 100 cfu/mL within 2 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1079 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA5 | TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 80 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 30.69 ± 7.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1080 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTCCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Aptamer-functionalized QD and UCNP nanoprobes conjugated with partially complementary DNA-modified magnetic beads for separation of different bacteria. | The limit of detection was 15 cfu/mL for S. aureus with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1081 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 28 cfu/mL for L. monocytogenes with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1082 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 25 cfu/mL for P. aeruginosa with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1083 | https://doi.org/10.1002/slct.201801008 | 2018 | Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNA-modified magnetic beads for separation. | The limit of detection was 12 cfu/mL for S. typhimurium with a linear range from 10(2)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1084 | 29729642 | 2018 | Design and fabrication of an electrochemical aptasensor using Au nanoparticles/carbon nanoparticles/cellulose nanofibers nanocomposite for rapid and sensitive detection of Staphylococcus aureus | Staphylococcus aureus aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an impedimetric aptasensor using AuNPs/CNPs/CNFs nanocomposites for the rapid detection of S. aureus. | Exhibited a wide linear dynamic range 1.2 × 10(1) to 1.2 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1093 | 30350564 | 2018 | Aptamer-Based TB Antigen Tests for the Rapid Diagnosis of Pulmonary Tuberculosis: Potential Utility in Screening for Tuberculosis | H63 SL-2-M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Developed an Aptamer ALISA and an electrochemical sensor (ECS) for the direct detection of HspX in sputum. | Aptamer ALISA demonstrated excellent sensitivity of 94.1% (95% CI, 86.8–98%) and specificity of 100% (95% CI, 98.4–100%). Aptamer-based ECS detected HspX at ∼13 pM. | N/A | N/A | N/A | Biosensor | N/A | ALISA: 5′-Biotinylated and ECS: 5'-Methylene Blue (MB) and 3'-Thiolated | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1094 | 30413894 | 2018 | An impedimetric aptasensor for Shigella dysenteriae using a gold nanoparticle-modified glassy carbon electrode | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGGATTAGTCAAGAGGTAGACGCACATA | 87 | N/A | ssDNA | Shigella Dysenteriae (PTCC 1188) | Outer membrane protein (OMP) | Developed an impedimetric aptasensor using GCE modified with AuNPs for the detection of S. dysenteriae. | Display linear dynamic range that extends from 10(1) to 10(6) CFU/mL and a limit of detection of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1121 | 30187142 | 2018 | Colorimetric aptasensor for Campylobacter jejuni cells by exploiting the peroxidase like activity of Au@Pd nanoparticles | aptamer | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni | Surface protein | Develop a colorimetric aptasensor based on an aptamer and Au@Pd NPs peroxidase for the determination of C. jejuni in the milk sample. | The Limit of Detection (LOD) achieved was 10 CFU/mL in phosphate-buffered saline and 100 CFU/mL in milk samples with a linear range from 10 to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1122 | 29649475 | 2018 | Use of DNA aptamer for sandwich type detection of Listeria monocytogenes | LM6-116 | AGTATACGTATTACCTGCAGCTACTCGTTATTTCGTAGCACTTTTCCCCACCACCTTGGTGCGATATCTCGGAGATCTTGC | 81 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Surface protein | Develop a two-site binding sandwich assay for capture and detection of L. monocytogenes. | Display LOD of 2.5 CFU L. monocytogenes in 500 μl buffer and 10 CFU/25 g turkey deli meat sample. | N/A | N/A | 74.4 ± 52.69 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1123 | 29414089 | 2018 | A sensitive Potentiometric resolved ratiometric Photoelectrochemical aptasensor for Escherichia coli detection fabricated with non-metallic nanomaterials | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Surface protein | Develops a sensitive potentiometric resolved ratiometric photoelectrochemical aptasensor for the detection of E. coli. | Achieved an extremely low detection limit (LOD) of 0.66 cfu/mL and showed a wide linear range (2.9 cfu/mL to 2.9 × 10(6) cfu/mL). | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1124 | 29870692 | 2018 | Carbon nanotube-based aptasensor for sensitive electrochemical detection of whole-cell Salmonella | Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an amino-modified aptasensor using MWCNTs-deposited ITO electrode for the detection of Salmonella. | It possesses a linear range from 10 mV/s to 90 mV /s, and the detection limit was 5.5 × 10(1) cfu/mL and 6.7 × 10(1) cfu/mL for S. Enteritidis and S. Typhimurium, respectively. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1125 | 33418673 | 2018 | Fast and Sensitive Detection of Salmonella in Milk Samples Using Aptamer-Functionalized Magnetic Silica Solid Phase and MCM-41-Aptamer Gate System | S. enterica specific aptamer | TATGGCGGCGTCACCCGACGGGGACTT | 27 | N/A | ssDNA | Salmonella Enterica | Whole cell | Developed an aptamer-gated MCM-41 silica system (Fe3O4@SiO2@pGMA and MCM-41 particles) to detect S. enterica in food samples. | The linear range is from 2000 CFU/mL to 104 CFU/mL in milk, with the LOD of 2336 cells. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1150 | 29550346 | 2018 | An aptasensor for staphylococcus aureus based on nicking enzyme amplification reaction and rolling circle amplification | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A chemiluminescence aptasensor for S. aureus detection based on aptamer recognition and the DNA amplification cycle (NEAR-RCA) was developed. | Detect S. aureus specifically with a good linear correlation at 5-10(4) CFU/mL and limit of detection (LoD) of 5 CFU/mL. | N/A | N/A | 210.70 ± 135.91 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1151 | 29777309 | 2018 | Fluorometric determination of Vibrio parahaemolyticus using an F0F1-ATPase-based aptamer and labeled chromatophores | V. parahaemolyticus aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an F0F1-ATPase-based aptasensor for the fluorometric determination of V. parahaemolyticus. | The relative fluorescence varies linearly over the 15 to 1.5 × 10(6) cfu/mL Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1180 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | Sa1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1181 | 32254837 | 2018 | Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags | E1 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus. | The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1182 | 29901674 | 2018 | Aptamer immobilization on amino-functionalized metal-organic frameworks: an ultrasensitive platform for the electrochemical diagnostic of Escherichia coli O157:H7 | E.coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Electrochemical biosensor based on amino-functionalized metal-organic frameworks (MOFs) for detection of Escherichia coli O157:H7. | Display linear range of 2.1×10(1) to 2.1×10(7) CFU/mL with a LOQ of 21 CFU/mL and LOD of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1190 | 29078201 | 2018 | Gold atomic cluster mediated electrochemical aptasensor for the detection of lipopolysaccharide | LPS aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptamer immobilized gold atomic cluster mediated, ultrasensitive electrochemical biosensor (Apt/AuAC/Au) for LPS detection. | Achieved a detection of LPS down to 7.94 × 10–21 M level with a wide dynamic range from 0.01 attomolar to 1 pM. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | The Apt/AuAC/Au electrode offers excellent stability when stored at 4°C for 1 week, with 95.54% of the signal retained. | N/A | N/A | N/A |
| ABdb_1191 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy employing an ultrasensitive aptasensor for the voltammetric determination of M. tuberculosis. antigen MPT64 in human serum. | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1192 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy where two different aptamers are immobilized on a gold electrode to synergistically bind the target MPT64 protein | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1193 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560, NCTC11168, 2 human isolates, and 3 food isolates) | Whole cell | A 2-stage label-free aptasensing platform was developed to detect C. jejuni and C. coli. | Detection limit (LOD) of 7.2×10^5 CFU/mL and linear range from 10(5) to 10(8) CFU/mL for C. jejuni. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1194 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Coli (ATCC 33559 and 3 food isolates) | Whole cell | Aptamers normally adsorb to gold nanoparticles (AuNPs) to protect them from salt-induced aggregation. | Detection limit (LOD) of 5.6×10^5 CFU/mL with a strong correlation (from 10(5) to 10(8) CFU/mL) for C. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1195 | 30019137 | 2018 | Aptamer based voltammetric biosensor for Mycobacterium tuberculosis antigen ESAT-6 using a nanohybrid material composed of reduced graphene oxide and a metal-organic framework | ESAT-6 binding aptamer (EBA) | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Develop a voltammetric aptasensor employing P-MOF-rGO nanohybrid as the sensitive sensing platform for ultrasensitive detection of ESAT-6. | Linear range: 1.0×10(−4) to 2.0×10(2) ng/mL and Limit of Detection (LOD): 3.3×10(−5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Compared with the initial current response, the aptsensor response decreased only about 3.5% after 50 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1196 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt1) | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A label-free fluorescent aptasensor was developed for the detection of Salmonella typhimurium using SYBR Green I. | Achieved a linear range of approximately 1530-96938 CFU/mL and a detection limit of 733 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1197 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt2) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | An aptasensor based on FRET between Rhodamine B and gold nanoparticles for the detection of Salmonella typhimurium was developed. | Achieved concentrations ranging from 1530 to 96938 CFU/mL, with a detection limit of 464 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1198 | 30359519 | 2018 | Ω-Shaped Fiber-Optic Probe-Based Localized Surface Plasmon Resonance Biosensor for Real-Time Detection of Salmonella Typhimurium | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-immobilized Ω-shaped fiber-optic localized surface plasmon resonance (FOLSPR) biosensor for S. Typhimurium detection. | Achieved high detection sensitivity for S. Typhimurium down to 128 CFU/mL within a linear range from 5 × 10(2) to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1199 | https://doi.org/10.1016/j.snb.2017.08.160 | 2018 | Nanoporous gold as a suitable substrate for preparation of a new sensitive electrochemical aptasensor for detection of Salmonella typhimurium | Anti-S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a label-free electrochemical aptasensor based on nanoporous gold (NPG/Au/GCE) for the detection of Salmonella typhimurium. | Capable of detecting S. typhimurium in a wide linear dynamic range 6.5 × 10(2) to 6.5 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1200 | 29533818 | 2018 | Culture-free, highly sensitive, quantitative detection of bacteria from minimally processed samples using fluorescence imaging by smartphone | S. aureus–specific aptamer (Sap) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (USA300) | Surface protein | Developed a smartphone-based detection using aptamer-functionalized fluorescent magnetic nanoparticles (FMNPs) for Staphylococcus aureus. | Showed a minimum detectable concentration as low as 10 cfu/ml in a peanut milk sample within 10 min. | N/A | N/A | 3.03 nM | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1201 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | E. coli aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits were 100 cfu/mL in milk, 80 cfu/mL in human serum, and 80 cfu/mL in human urine for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-Cyanine3 (Cy3) Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1202 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | S. typ aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits of 150 cfu/mL in milk, 120 cfu/mL in human serum, and 120 cfu/mL in human urine for S. typ. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-FAM Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1224 | 30637436 | 2019 | Aptamer-mediated colorimetric and electrochemical detection of Pseudomonas aeruginosa utilizing peroxidase-mimic activity of gold NanoZyme | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-mediated tunable NanoZyme colorimetric and electrochemical sensors for the detection of Pseudomonas aeruginosa. | Possess a detection limit of the electrochemical sensor of ~ 60 CFU/mL in water within 10 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1225 | 31216306 | 2019 | Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dots | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop an aptamer-based (Apt-MNPs) fluorescence assay for the determination of Salmonella Typhimurium. | Exhibit a linear range of 10 to 10(10) cfu/mL with LOD of 1 cfu/mL within 2 h, and is successfully applied to the analysis of spiked food samples with good recoveries from 90% to 105%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1227 | 30877887 | 2019 | A new aptamer/polyadenylated DNA interdigitated gold electrode piezoelectric sensor for rapid detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a piezoelectric sensor (Au IDE-MSPQC) based on magnetic bead/aptamer/polyadenylated-DNA for the detection of P. aeruginosa. | The limits of detection (LOD) of the method were as low as 9 CFU/mL in buffer and 52 CFU/mL in a simulated blood sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1228 | 31183576 | 2019 | Surface-enhanced Raman spectroscopic single step detection of Vibrio parahaemolyticus using gold coated polydimethylsiloxane as the active substrate and aptamer modified gold nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-based SERS method using Au-PDMS film for the detection of V. parahaemolyticus. | The detection limit is 12 cfu/mL with a wide linear range from 1.2 × 10(2) to 1.2 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1229 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours, and the MIC for E. coli was approximately 0.1 and 1 μg/mL for gentamicin and amikacin, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1230 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for S. aureus was approximately 1 and 0.1 μg/mL for gentamicin and amikacin, respectively, | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1231 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for P. aeruginosa was approximately 1 μg/mL for both gentamicin and amikacin. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1232 | https:doi.org10.1039C9AY01509D | 2019 | A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosa | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on a glassy carbon electrode (GCE) modified with nano-sized chitosan particles (NCs) for sensitive and simultaneous detection of P. aeruginosa. | Displayed a low detection limit of 3 CFU/mL, wide linearity of 10(1)–10(7) CFU/mL and a recovery rate from 93.2% to 124%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1233 | https://doi.org/10.1021/acssuschemeng.9b01314 | 2019 | Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa Detection | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | An electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples. | Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1234 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer1 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1235 | 31362188 | 2019 | Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samples | P. aeruginosa aptamer2 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | A dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa. | The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1236 | 31279171 | 2019 | A novel enzyme-free electrochemical biosensor for rapid detection of Pseudomonas aeruginosa based on high catalytic Cu-ZrMOF and conductive Super P | P-aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a Cu-ZrMOF@Aptamer@DNA nanocomposite-based enzyme-free electrochemical biosensor to detect P. aeruginosa. | Exhibit a wide linearity range of 10-10(6) CFU/mL and a low limit of detection of 2 CFU/mL within 120 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate | N/A | The biosensor had acceptable storage stability (98.1% and 83.9%) within 7 days of storage at 4°C. | N/A | N/A | N/A |
| ABdb_1237 | 31655899 | 2019 | Impedimetric aptasensor for Pseudomonas aeruginosa by using a glassy carbon electrode modified with silver nanoparticles | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on an immobilised NH2-aptamer that was covalently attached to the AgNP/GCE surface for the detection of P. aeruginosa. | The impedance increases on going from 10(2) to 10(7) CFU/mL concentrations of P. aeruginosa, and the detection limit is 33 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1245 | 30825657 | 2019 | A reduced graphene oxide-titanium dioxide nanocomposite based electrochemical aptasensor for rapid and sensitive detection of Salmonella enterica | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-TiO2 electrochemical aptasensor for the detection of Salmonella bacteria. | Exhibited high sensitivity with a wide detection range (10(8) to 10(1) cfu/mL), a low detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Showed good durability up to 21 days with a 10% decrease in signal after 30 days of non-use. | N/A | N/A | N/A |
| ABdb_1246 | https://doi.org/10.1016/j.foodcont.2019.106806 | 2019 | A competitive enzyme linked aptasensor with rolling circle amplification (ELARCA) assay for colorimetric detection of Listeria monocytogenes | Aptamer | TATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 48 | N/A | ssDNA | Listeria Monocytogenes (CMCC 54007) | Whole cell | Developed an enzyme-linked aptasensor with rolling circle amplification (ELARCA) assay for the detection of L. monocytogenes. | Showed a limit of detection (LOD) of 4.6 × 10(2) CFU/mL in pure culture, and in fresh lettuce showed an LOD of 6.1 × 10(3) CFU/g. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1249 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA60 | TCACGACGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCTATGTGC | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1250 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA54 | CGACGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCTATG | 54 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1251 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA48 | CGACCAGCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTCT | 48 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1252 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA40 | CCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGCTGGTC | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1253 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA36 | GCCTTCTAACAGAATGTTGTTAGATAGCTTTGAAGC | 36 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | LA36 has good specificity. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1254 | 30771102 | 2019 | Fluorometric determination of lipopolysaccharides via changes of the graphene oxide-enhanced fluorescence polarization caused by truncated aptamers | LA22 | TTCTAACAGAATGTTGTTAGAT | 22 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium), Escherichia Coli (E. Coli) 055:B5 and Pseudomonas Aeruginosa 10 | Lipopolysaccharide (LPS) | Developed an aptamer-based graphene oxide-based fluorescence polarization assay to detect LPSs from S. typhimurium, P. aeruginosa 10 and E. coli 055:B5. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1255 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | A-Apt | TACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCAAAAAAAAAA | 71 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1256 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | D-Apt | CCTCAGCATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGCGCAGTGCACCCACCCACCCACCC | 90 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (3'-end phosphorylation) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1257 | 31307721 | 2019 | Dual-recognition surface-enhanced Raman scattering(SERS)biosensor for pathogenic bacteria detection by using vancomycin-SERS tags and aptamer-Fe3O4@Au | S. aureus-aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a dual-recognition SERS biosensor using Vancomycin-Au@MBA and aptamer-Fe3O4@Au for the detection of pathogenic bacteria. | A detection limit of 3 cells/mL with a wide dynamic linear range from 10 to 10(7) cells/mL can be achieved within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1274 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | Specific aptamer (S-probe) | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1275 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | General aptamer (G-probe) | AGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCT | 39 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Ethanolamine | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1276 | 30352198 | 2019 | A novel aptamer-based test for the rapid and accurate diagnosis of pleural tuberculosis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Aptamer-Linked Immobilized Sorbent Assay (ALISA) was developed to detect pleural TB (pTB). | Detects pTB with ~93% sensitivity and ~98% specificity. | N/A | N/A | N/A | Diagnostic | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1277 | 30988611 | 2019 | Structural switching electrochemical DNA aptasensor for the rapid diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Developed a structural switching electrochemical aptasensor using methylene blue (MB) and an aptamer for the detection of HspX in CSF samples for the diagnosis of TBM. | Can detect as low as 10 pg HspX in CSF with ~95% sensitivity and ~97.5% specificity in ≤30 minutes. | N/A | N/A | N/A | Diagnostic | N/A | 5'-Methylene Blue (MB) and 3'-C6 thiol modification | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1278 | 31380872 | 2019 | A transcription aptasensor: amplified, label-free and culture-independent detection of foodborne pathogens via light-up RNA aptamers | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a transcription aptasensor by using a light-up RNA aptamer for culture-free detection of intact foodborne pathogens. | The dynamic range was 10(2)-10(6) CFU/mL, and the LOD of the transcription aptasensor was estimated to be 77.0 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1279 | 31617347 | 2019 | Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color Emission | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | An ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus. | The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1280 | 31036183 | 2019 | Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensor | B. melitensis aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis | Whole cell | A QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples. | The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL. | 15 | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1281 | 31718045 | 2019 | Aptamer Affinity-Bead Mediated Capture and Displacement of Gram-Negative Bacteria Using Acoustophoresis | GN6 aptamer | ATACCAGCTTATTCAATTGGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGAAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Gram-negative Bacteria | Whole cell | Develop aptamer-modified microbeads and an acoustophoresis method for capturing and displacing gram-negative bacteria. | It achieved high recovery (up to 98%) and high purity (up to 99.5%). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1324 | 31732807 | 2019 | A glassy carbon electrode modified with reduced graphene oxide and gold nanoparticles for electrochemical aptasensing of lipopolysaccharides from Escherichia coli bacteria | LPS Aptamer | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 | Lipopolysaccharide (LPS) | An electrochemical aptasensor immobilized on a GCE modified with reduced graphene oxide and gold nanoparticles (RGO/AuNPs) was developed for the voltammetric determination of LPS from E. coli 055:B5. | Limit of Detection (LOD) of 1 fg/mL (using Mg/CQD media) or 30 fg/mL (using hexacyanoferrate). | N/A | N/A | 12 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1325 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅰ (MAA Ⅰ) | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1326 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅱ (MAA Ⅱ) | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1327 | 31446952 | 2019 | Aptamer-based SERS biosensor for whole cell analytical detection of E. coli O157:H7 | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | SERS-based aptasensor using 4-aminothiophenol-gold nanoparticle complexes was developed for the detection of E. coli O157:H7. | Low concentrations of E. coli O157:H7 were detected and quantified within 20 min in both pure culture (∼10(1) CFU/mL) and ground beef samples (∼10(2) CFU/mL), and a linear range from 10(2) to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1328 | https://doi.org/10.3390/app9020295 | 2019 | Development of an Electrochemical Biosensor for Rapid and Effective Detection of Pathogenic Escherichia coli in Licorice Extract | Aptamer (Seq.1) | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an aptamer-based electrochemical biosensor for the rapid detection of E. coli in liquorice extract. | Concentrations ranging from 5.0 × 10^2 CFU/mL to 5.0 × 10^7 CFU/mL exhibited a linear trend, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1329 | 31410576 | 2019 | Electrochemical determination of Salmonella typhimurium by using aptamer-loaded gold nanoparticles and a composite prepared from a metal-organic framework (type UiO-67) and graphene | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An aptamer-based assay based on a metal-organic framework-graphene composite of type UiO-67/GR and an aptamer-gold nanoparticles-horseradish peroxidase (Apt-AuNP-HRP) conjugate is described for the determination of S.typhimurium. | Linear detection range from 2 × 10(1) – 2 × 10(8) cfu/mL and a lower detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | 91.3% of the original current is retained after storage at 4°C for 14 days with the modified electrodes, allowing monitoring of 2 × 10(5) cfu/mL S. typhimurium. | N/A | N/A | N/A |
| ABdb_1330 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E1 | AAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensor is 1 x 10(5) CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1331 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E2 | AAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 57 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1332 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S1 | AAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 77 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensors is 1 x 10(6) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1333 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S2 | AAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 103 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1334 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-E1 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1335 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-E2 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 77 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1336 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S1 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 97 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1337 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 30A-S2 | AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 123 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (30A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1338 | 30622036 | 2019 | An electrochemical aptasensor for staphylococcal enterotoxin B detection based on reduced graphene oxide and gold nano-urchins | Aptamer SEB | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | An electrochemical aptasensor was developed using a screen-printed electrode modified with reduced graphene oxide (rGO) and gold nano-urchins (AuNUs) for the detection of SEB. | A wide linear range of 5.0–500.0 fM was observed, with a detection limit of 0.21 fM. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1339 | 30522085 | 2019 | A label-free impedimetric aptasensor for the detection of Bacillus anthracis spore simulant | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus (ATCC 11778 and ATCC 14579) | B. anthracis spore simulant (B. cereus spore 14579) | Developed an impedimetric DNA-based aptasensor based on an aptamer immolized on a gold screen-printed electrode for a single-step detection of B. cereus spores. | Spores were detected with a linear range between 10(4) CFU/ml and 5 × 10(6) CFU/ml and a detection limit of 3 × 10(3) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1340 | 30078622 | 2019 | Electrochemical aptasensor using optimized surface chemistry for the detection of Mycobacterium tuberculosis secreted protein MPT64 in human serum | Aptamer | TCACTTCAAATGTGCGCTTC-GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC-CGTCAAAACAGGGGGTAGAA | 80 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor using thiol PEGylated aptamer HS-(CH2)6-OP(O)2O-(CH2CH2O)6-TTTTT-aptamer and 6-mercaptohexanol for the detection of MPT64. | A spiked human serum sample displays a limit of detection of 81 pM in 30 minutes with the long linker aptamer/MCH. | N/A | N/A | 8.92 nM | Biosensor | N/A | HS-(CH2)6-OP(O)2O-(CH2CH2O)6-5'-TTTTT-aptamer-3' and HS-(CH2)6-5'-TTTTT-aptamer-3' | N/A | N/A | N/A | N/A | N/A |
| ABdb_1345 | 30797466 | 2019 | Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteria | E. coli O157:H7 aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7. | The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1346 | https://doi.org/10.1016/j.foodcont.2018.11.048 | 2019 | Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor | Sh. flexneri binding aptamer | CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG | 40 | N/A | ssDNA | Shigella Flexneri (ATCC 12022) | Whole cell | Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri. | Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less. | 14 | N/A | 42.6 ± 7.11 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1347 | 31196418 | 2019 | Functional chimera aptamer and molecular beacon based fluorescent detection of Staphylococcus aureus with strand displacement-target recycling amplification | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescent detection of S. aureus based on a functional chimaera and a molecular beacon. | Display a broad concentration range from 80 CFU/mL to 8 × 10(6) CFU/mL and the detection limit of 39 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1348 | 31318203 | 2019 | Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria | S. mutans-binding aptamer | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Developed a DNA-engineered nanozyme interface using aptamers for the detection of dental bacteria. | The detection limit is 12 CFU/mL, and the linear range is 0 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1369 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (U433, U556-ESBL, B12327, U5307, U6267-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1370 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 2 | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii (P762, T800, R4197, R4299, R4356) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1371 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 3 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-(N45)-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Klebsiella Pneumoniae (PAE1, PAE2, PAE3, PAE4, PAE5) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1372 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 4 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (KP1-ESBL, KP2-ESBL, KP3, KP4-ESBL, KP5-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | 3'-Thiolated (SH-(CH2)3) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1374 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 6 | ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA | 70 | N/A | ssDNA | Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1375 | 32451800 | 2020 | Inhibition of Salmonella enteritidis biofilms by Salmonella invasion protein-targeting aptamer | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | Salmonella invasion proteinA (SipA) | An aptamer targets the SipA protein to inhibit Salmonella biofilm formation by interfering with the T3SS. | Co-incubation of Apt17 with ampicillin MIC/10 for 24 h inhibited the biofilms of S. enteritidis TM 6 and S. enteritidis TM 68 by 12.5% and 20.9% respectively. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1381 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt A | ATATACACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 43 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Staphylococcus aureus Protein A (SpA) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1382 | 32289369 | 2020 | Accurate MRSA identification through dual-functional aptamer and CRISPR-Cas12a assisted rolling circle amplification | Apt B | CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTT | 38 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 17802) | Penicillin binding protein 2a (PBP2a) | Dual-functional technology based on aptamer and CRISPR-Cas12a-assisted RCA for detection of MRSA. | Fluorescence intensity shows a linear correlation with the logarithm of MRSA concentration, ranging from 10(6) to 10(2) CFU/mL, spanning six orders of magnitude. | N/A | N/A | N/A | Detection | N/A | 3'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1383 | 32291246 | 2020 | Dual aptamer assay for detection of Acinetobacter baumannii on an electromagnetically-driven microfluidic platform | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Dual aptamer assay to diagnose AB by using an electromagnetically-driven microfluidic system. | Within 30 minutes, a limit of detection of only 100 CFU/reaction and a range of 10^2 to 10^5 CFU/reaction was obtained. | N/A | N/A | 6.8 ± 1.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1402 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-1 | AAAAAAAAAAAAAAAAAAAACCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 62 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1403 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1410 | https://doi.org/10.1007/s12161-020-01821-4 | 2020 | Fluorescent Turn-on Aptasensor of Staphylococcus aureus Based on the FRET Between Green Carbon Quantum Dot and Gold Nanoparticle | Staphylococcus aureus aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed FRET-based aptasensor with CQDs and GNPs for the detection of S. aureus. | Linear detection range of 10⁸ to 10¹ CFU/mL with a detection limit (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1411 | 32892935 | 2020 | Naked-eye based point-of-care detection of E.coli O157: H7 by a signal-amplified microfluidic aptasensor | Anti-E.coli O157: H7 aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (BNCC 191201) | Whole cell | Developed an eye-based aptasensor (EA-Sensor) for the detection of E.coli O157:H7. | Display a linear range of 500–5 × 10(7) CFU/mL and LOD of 250 CFU/mL and 400 CFU/mL for buffered and milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1412 | https://doi.org/10.1111/jfs.12868 | 2020 | Ultrasensitive detection of Listeria monocytogenes using solid-state electrochemiluminescence biosensing based on the quenching effect of ferrocene on ruthenium pyridine | Aptamer (ssDNA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115, Serotype 4 b) | Whole cell | Developed an ECL biosensing switch system based on the specific recognition of an aptamer and the destruction of pyridine ruthenium by ferrocene for the detection of L. monocytogenes. | Produced a good linear relationship over the concentration range of 1.4 × 10(1)–1.4 × 10(6) CFU/ml and a detection limit of 4 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1413 | https://doi.org/10.3390/IECB2020-07079 | 2020 | Detection of Listeria innocua by Acoustic Aptasensor | Aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Innocua | Whole cell | QCM-based aptasensor for the detection of pathogenic bacteria Listeria innocua. | The achieved limit of detection was approximately 1.6 × 10(3) CFU/mL and broad range of 5 × 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1414 | https://doi.org/10.1016/j.foodcont.2020.107808 | 2020 | Development of a fluorescence aptasensor for rapid and sensitive detection of Listeria monocytogenes in food | L. monocytogenes Aptamer | GGGAGCTCAGAATAAACGCTCAATACTATCGCGGGACAGCGCGGGAGGCACCGGGGATTCGACATGAGGCCCGGATC | 77 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | A fluorescence aptasensor based on aptamer-UCNP and aptamer-MNP complex was developed for the detection of L. monocytogenes. | A low limit of detection of 8 cfu/mL was estimated from the range of 68 to 68 × 10(6) cfu/mL. | N/A | N/A | 48.74 ± 3.11 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1436 | 32350613 | 2020 | A fluorescent aptasensor for Staphylococcus aureus based on strand displacement amplification and self-assembled DNA hexagonal structure | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A fluorescent aptasensor based on MB-apt-cDNA duplex for S. aureus in milk samples. | Exhibits a broad linear range from 7 to 7 × 10(7) CFU/mL, with a detection limit of 1.7 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1437 | 32594319 | 2020 | SiC-functionalized fluorescent aptasensor for determination of Proteus mirabilis | Aptamer | TTGCTGTAGGGGAGGAGGGTGGGT | 24 | N/A | ssDNA | Proteus Mirabilis (ATCC 12453) | Whole cell | Developed a fluorescent aptasensor based on aptamer-modified SiC quantum dots (DNA-SiC QDs) for the determination of Proteus mirabilis. | The linear range is from 10(3) to 10(8) CFU/mL, and the limit of detection is 526 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1438 | 32070611 | 2020 | Rapid and sensitive detection of Salmonella Typhimurium using nickel nanowire bridge for electrochemical impedance amplification | Aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor using an aptamer-coated gold interdigitated microelectrode and antibody-modified NiNWs to detect Salmonella typhimurium. | This electrochemical aptasensor quantitatively detected Salmonella at concentrations ranging from 10(2) to 10(6) CFU/mL within 2 h, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1439 | 31726272 | 2020 | CdS quantum dots/Au nanoparticles/ZnO nanowire array for self-powered photoelectrochemical detection of Escherichia coli O157:H7 | E. coli aptamer | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Surface protein | Developed a photoelectrochemical (PEC) platform (CdS QDs/Au NPs/ZnO NWs) for the detection of E. coli O157:H7. | Exhibited a wide linear range of 10-10(7) CFU/mL with the detection limit as low as 1.125 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 15 days, the PEC aptasensor still retained 87% of its initial sensitivity. | N/A | N/A | N/A |
| ABdb_1440 | 31655050 | 2020 | Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensor | S. Typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica. | Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | ssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_1453 | 34567619 | 2020 | An aptamer-based shear horizontal surface acoustic wave biosensor with a CVD-grown single-layered graphene film for high-sensitivity detection of a label-free endotoxin | Aptamer | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Endotoxin (Lipopolysaccharide (LPS)) | Developed SH-SAW biosensor with chemical vapour deposition (CVD)-grown single-layered graphene (SLG) for endotoxin detection. | The biosensor exhibited a linear detection range of 0-100 ng/mL and a detection limit (LOD) of 3.53 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1454 | 33241794 | 2020 | Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticles | S. typhimurium aptamer | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce. | Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1468 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | Ab-Apt | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1469 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | LPS-Apt | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Acinetobacter Baumannii | Lipopolysaccharide (LPS) | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1475 | 32774812 | 2020 | Point-of-care detection of Escherichia coli O157:H7 in water using AuNPs-based aptasensor | Apt 2 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (EHEC) (NTCC 12900) | Whole cell | Developed an aptamer-based AuNPs bioassay to detect EHEC in contaminated water. | Exhibited a good linear response over a wide concentration range of 876 to 107 CFU/mL and a low detection limit (LOD) of 263 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1486 | 32151909 | 2020 | Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimer | S. Sonnei aptamer | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Developed a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei. | Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1489 | https://doi.org/10.1016/j.foodcont.2019.106761 | 2020 | Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food | E.coli aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | A novel upconversion fluorescence sensor using magnetic nanoparticles (MNPs) and cDNA-upconversion nanoparticles (UCNPs) for E.coli was developed. | Achieved a lower limit of detection (10 cfu/mL) in the linear range of 58–58 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1493 | 32800140 | 2020 | Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detections | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells. | Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1496 | https://doi.org/10.1016/j.sbsr.2019.100313 | 2020 | Aptamer-NanoZyme mediated sensing platform for the rapid detection of Escherichia coli in fruit juice | Aptamer P12–31(EC 12–31 TRUNC) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | An aptamer and NanoZyme-based colorimetric and electrochemical assay was developed for EC detection in fruit juice. | Displayed superior linearity in the range of 10–10(9) CFUs/mL and a low-end detection limit of ~10 CFU within 5 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1497 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt1 | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1498 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt2 | CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC | 80 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1499 | 32200887 | 2020 | DNA aptamer-based non-faradaic impedance biosensor for detecting E. coli | OMP Ag1 aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed an impedance-based biosensor using aptamer-functionalized Interdigitated Electrode (IDE) arrays to detect E. coli. | Detection limit of 9 cfu/mL and linear concentration range of 25–1000 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1501 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 27 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1502 | 32600757 | 2020 | A novel fluorometric aptasensor based on carbon nanocomposite for sensitive detection of Escherichia coli O157:H7 in milk | Anti-E. coli O157:H7 aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 25922) | Lipopolysaccharide (LPS) | CIP@MWCNT-based fluorometric aptasensor for detection of E. coli O157:H7. | The detection limit was as low as 7.15 × 10(3) cfu/mL in pure culture and 3.15 × 10(2) cfu/mL in contaminated milk with a linear range of 10(3)-10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | The fluorescent values of the CIP@MWCNT-based aptasensor were above 91.2% of the initial value at 4°C and −20°C after 4 wk. | N/A | N/A | N/A |
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1540 | 34664941 | 2021 | Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite Sheets | S. Typhimurium aptamer (ST-NH2) | TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | ICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium. | Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂) | ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities. | N/A | N/A | N/A | N/A |
| ABdb_1541 | 33285125 | 2021 | An aptamer biosensor based dual signal amplification system for the detection of salmonella typhimurium | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ASI 1174) | Whole cell | Developed a signal-cascade-amplification method named “immuno-HCR-SERS” for the detection of S. typhimurium. | Highly sensitive detection showing a linear range from 10 to 10(5) CFU/mL, with a limit of detection (LOD) of 6 CFU/mL in 3.5 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1542 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Capture aptamer (Bapt) | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1543 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Target aptamer (Tapt) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1544 | 34051601 | 2021 | Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus. | Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1545 | https://doi.org/10.1016/j.electacta.2021.139633 | 2021 | A new electrochemical aptasensor based on gold/nitrogen-doped carbon nano-onions for the detection of Staphylococcus aureus | Anti-S. aureus aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on SPEs modified with AuNPs and NCNOs for the detection of S. aureus. | Measured S. aureus quickly with a limit of detection of 3 CFU/mL in the linear range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1546 | 34660993 | 2021 | Detection of Listeria monocytogenes Using Luminol-Functionalized AuNF-Labeled Aptamer Recognition and Magnetic Separation | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptamer-linked biofunctional magnetic nanomaterial system for highly sensitive and specific LM detection. | Display a linear concentration range 1.0 × 10(1)-1.0 × 10(5) CFU/mL and detect L. monocytogenes at levels as low as 6 CFU/mL in milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1547 | 34107210 | 2021 | A Low-Field Magnetic Resonance Imaging Aptasensor for the Rapid and Visual Sensing of Pseudomonas aeruginosa in Food, Juice, and Water | Anti-P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a low-field magnetic resonance imaging (LF-MRI) aptasensor based on the difference in magnetic behaviour of two magnetic nanoparticles with diameters of 10 (MN10) and 400 nm (MN400) for the rapid detection of P. aeruginosa. | Show a detection limit of 100 cfu/mL with a wide linear range from 3.1 × 10(2) to 3.1 × 10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1548 | 34396009 | 2021 | DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid Killing | MRSA aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Apt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation. | Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) and 5'-FITC Labeled | The aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination. | N/A | N/A | N/A | N/A |
| ABdb_1549 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1550 | 33076089 | 2021 | Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium | Aptamer2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor using gold nanoclusters (aptamers@BSA-AuNCs) for the detection of S. typhimurium. | Exhibited a wide linear range of 10(1)-10(6) cfu/mL with a detection limit as low as 1 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1551 | 33076147 | 2021 | Ratiometric fluorescence resonance energy transfer aptasensor for highly sensitive and selective detection of Acinetobacter baumannii bacteria in urine sample using carbon dots as optical nanoprobes | Ab aptamer | CAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 71 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Develop an ingenious ratiometric fluorescent aptasensor for the detection of (Ab) bacteria based on FRET between ortho-phenylenediamine carbon dots (o-CD), nitrogen-doped carbon nanodots (NCND), and graphene oxide (GO). | Display linear range from 2.0 × 10(3) to 4.5 × 10(7) cfu/mL and the low detection limit of 3.0 × 10(2) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After a storage period of 4 weeks, over 90% of the initial response remained of the aptasenosr. | N/A | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1553 | 34578762 | 2021 | Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective Biomarker | Aptamer | GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC | 90 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT6/CFP10 fusion proteins (EC proteins) | Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples. | Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1554 | 34940268 | 2021 | One-Step Fabrication of Stimuli-Responsive Chitosan-Platinum Brushes for Listeria monocytogenes Detection | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Internalin A (InlA) | Developed a label-free electrochemical biosensor using a new one-step simultaneous sonoelectrodeposition of platinum and chitosan (CHI/Pt) to create a biomimetic nanostructure for Listeria monocytogenes detection. | LOD of the CHI/Pt-aptamer brushes in PBS was 2.5 ± 0.3 CFU/mL, 3.3 ± 0.9 CFU/mL in chicken broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1555 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1556 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10899) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1557 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A1 | TAGAGATATGACAGCGGGGAAGGTTAAGAGGCGCTAGGAG | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1558 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A3 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1559 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | ATAGGAGTCACGACGACCAGAAGCGGGCAGCTCCACCGGTAGGCTCCGAGTCATCACGGTCGTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (CICC 21617) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1560 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B1P | ATAGGAGTCACGACGACCAGGGGGGCGGGCGGGCCAGGCGAGGGGCAGGGCGTGGAGGGCTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 56.56 ± 10.51 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1561 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B16P | ATAGGAGTCACGACGACCAGGGATGGGGCCGCGCGGGGTGGGGGCGCGAGGGCCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | 49.83 ± 7.69 nM | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1562 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | B25P | ATAGGAGTCACGACGACCAGGCCGCCCGGGGACGGGGGCGGCGGGGAGGAGGGCGGCGGGTATGTGCGTCTACCTCTTGA | 80 | N/A | ssDNA | Cronobacter Sakazakii (CICC 21562) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Detection limit as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1563 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A6 | GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1564 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A16 | GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1565 | 34553439 | 2021 | The systemic characterization of aptamer cocktail for bacterial detection studied by graphene oxide-based fluorescence resonance energy transfer aptasensor | A18P | CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CICC 21484) | Whole cell | Developed a fluorescence resonance energy transfer polyaptasensor based on an aptamer cocktail/graphene oxide for bacterial detection. | Show a linear range for monoaptasensor in the range of 1 × 10(1) to 1 × 10(9) CFU/mL and for polyaptasensor ranging from 1 × 10(1) to 1 × 10(7) CFU/mL with an LOD of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1566 | 34731314 | 2021 | An electrochemical aptasensor for Mycobacterium tuberculosis ESAT-6 antigen detection using bimetallic organic framework | EBA | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | A label-free electrochemical aptasensor was developed using NG@Zr-MOF-on-Ce-MOF@Tb nanohybrid for sensitive detection of ESAT-6. | Displayed a wide linear range from 100 fg/mL to 10 ng/mL with a limit of detection (LOD) of 12 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (PO4(-3)) | N/A | The current remained at 95.77% and 88.72% of the initial current after storing at at 4℃ for 8 days and 16 days, respectively. | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1568 | 33421762 | 2021 | Controllable design of a nano-bio aptasensing interface based on tetrahedral framework nucleic acids in an integrated microfluidic platform | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 (ATCC 43889) | Whole cell | Developed a tetrahedral framework nucleic acids-based aptasensing interface in the microfluidic system for E. coli O157: H7 detection and antimicrobial susceptibility testing (AST) determination. | A calibration curve was constructed over 10(1) to 10(5) CFU/mL, with a limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-CGGAATTCCG) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1569 | 33479797 | 2021 | A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probes | VP aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination. | Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1578 | 33836431 | 2021 | Ultra-sensitive photoelectrochemical aptamer biosensor for detecting E. coli O157:H7 based on nonmetallic plasmonic two-dimensional hydrated defective tungsten oxide nanosheets coupling with nitrogen-doped graphene quantum dots (dWO3•H2O@N-GQDs) | E.coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a novel PEC aptasensor based on dWO3•H2O@N-GQDs for ultrasensitive detection of E. coli O157:H7. | Achieved a limit of detection of 0.05 CFU/mL and a wide linear detection range from 0.1 to 10(4) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1579 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-V.P | TGGCTAGCTCAGTCATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTCCGCG | 60 | N/A | ssDNA | Vibrio Parahaemolyticus | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 4 CFU/mL for V.P. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1580 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-S.T | TGGCTAGCTCAGTCATATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAGCCGCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 7 CFU/mL for S.T. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1581 | 33303152 | 2021 | Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosa | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA. | The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity. | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1583 | 34945447 | 2021 | A Novel Photoelectrochemical Aptamer Sensor Based on CdTe Quantum Dots Enhancement and Exonuclease I-Assisted Signal Amplification for Listeria monocytogenes Detection | Aptamer | ATACCAGCTTATTCAATTCCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCGAGATTGCACTTACTATCT | 76 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed a photoelectrochemical aptasensor based on WO3, CdTe QDs, and Exo I auxiliary signal amplification for the detection of L. monocytogenes. | Showed a detection limit of 45 CFU/mL over the concentration range of 1.3 × 10(1) - 1.3 × 10 (7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1584 | 34053767 | 2021 | A novel smartphone-based colorimetric aptasensor for on-site detection of Escherichia coli O157:H7 in milk | Aptamer (Apt) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | A colorimetric aptasensor was developed using GNP-Apt coupling with an MWCNT@CIP probe for detecting E. coli O157:H7 in milk. | Display a concentration of 8.43 × 10(3) cfu/mL in pure culture, and 5.24 × 10(2) cfu/mL in artificially contaminated milk after 1h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1585 | 34970724 | 2021 | Colorimetric determination of Listeria monocytogenes using aptamer and urease dual-labeled magnetic nanoparticles and cucurbit[7]uril-mediated supramolecular assembly of gold nanoparticle | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a colorimetric strategy using apt-MNP-urease conjugate for the detection of L. monocytogenes. | Achieved a concentration range from 10 to 10(6) cfu/mL, and the visual determination can be done down to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1587 | 33590378 | 2021 | Sensitive colorimetric aptasensor based on g-C3N4@Cu2O composites for detection of Salmonella typhimurium in food and water | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A colorimetric aptasensor using graphitic carbon nitride (g-C3N4) nanosheets and copper oxide(I) (Cu2O) nanocrystals was developed for detecting S. typhimurium. | Exhibited linear range from 1.5 × 10(1) to 1.5 × 10(5) CFU/ml, with a detection limit of 15 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1589 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | L. mono-aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for L. mono was 5 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1590 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | E. coli-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 35150) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1591 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | L. mono-aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Listeria Monocytogenes | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) was 10 cells/mL for L. mono. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1592 | 33894956 | 2021 | A universal SERS-label immunoassay for pathogen bacteria detection based on Fe3O4@Au-aptamer separation and antibody-protein A orientation recognition | S. typhi-aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Staphylococcus aureus Protein A (SpA) | Developed a SERS aptasensor using aptamer-conjugated Fe3O4@Au magnetic nanoparticles (MNPs) and PA modified-SERS tags (Au@DTNB@PA) for the detection of bacteria. | The limit of detection (LOD) for S. typhi was 25 cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1595 | 34869216 | 2021 | Electrochemical Biosensing Interface Based on Carbon Dots-Fe3O4 Nanomaterial for the Determination of Escherichia coli O157:H7 | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A carbon dots-Fe3O4 nanomaterial (CDs-Fe3O4)-based electrochemical aptasensor for E. coli O157:H7 detection was developed. | Exhibited the detection range of 10–10(8) CFU/ml, and the detection limit of 6.88 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1597 | https://doi.org/10.1007/s13738-021-02384-9 | 2021 | Rapid and sensitive detection of Escherichia coli O157:H7 based on silver nanocluster fluorescent probe | E. coli O157:H7 aptamer | TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Detection of E. coli O157:H7 in food based on aptamer-modified silver nanocluster fluorescent probes. | The linear range was 10–10(6) CFU/mL, and the detection limit was 0.2549 CFU/mL in the buffer and 0.6031 CFU/mL in the milk simulation sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1598 | 10.33263/BRIAC112.87028715 | 2021 | Novel Competitive Voltammetric Aptasensor Based on Electrospun Carbon Nanofibers-Gold Nanoparticles Modified Graphite Electrode for Salmonella enterica serovar Detection | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor based on aptamer-linked GNPs/CNF-Chi/GEs for the detection of Salmonella enterica Serovar. | Exhibited a linear range of 10 to 10(5) CFU/mL with the limit of detection (LOD) 1.223 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1611 | 35573794 | 2022 | Aptamer-Targeted Drug Delivery for Staphylococcus aureus Biofilm | SA31 | GCAATGGTACGGTACTTCC-TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (DSM 20231) | Whole cell | Aptamer-targeted liposomes encapsulating antibiotics for accumulation and delivery to eradicate S. aureus biofilm. | SA31-modified liposomes fully eradicated all viable, culturable bacteria in all biofilm samples. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-5-propargylamino-ddUTP-Cy5 or 3'-N3 modified | N/A | SA23 appeared more stable than the other aptamers in plasma over a 16-hour incubation period. | N/A | N/A | N/A |
| ABdb_1614 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | AptBH | AAACCTGCTTATCTAAGGGGGGGAGGGGGGGTAGTGGGTGGGT | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | AptBH-AgNPs at a concentration of 100 μg/mL after 48 h inhibited 43% of the biofilm formation and degraded 63% of the formed biofilm. | N/A | N/A | N/A | Therapeutics | N/A | 3'-Biotinylated | AgNPs-AptBH is weakly toxic, with cell viability of 96% even at 100 μg/mL. At 75 and 100 μg/mL, these concentrations caused ∼approximately 9% and 11% hemolysis, respectively. | AgNPs-AptBH complex has not decomposed over time for 360 min in the cell culture medium. | Best Candidate | N/A | N/A |
| ABdb_1615 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1616 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-6 | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1617 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1618 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1619 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-6 | ACACCAGCGTATTCTCTTGGGGGGAGGGGGGGTTGGGGGTCGGT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1620 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-1 | GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1621 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-2 | GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1622 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-3 | TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1623 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-4 | TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1624 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-5 | CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1625 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-6 | CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1626 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-7 | GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1627 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | FAM | GCAATGGTACGGTACTTCCCAAAAGTGCACGCTACTTTGCTAA | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1628 | 35842460 | 2022 | DNA-aptamer-nanographene oxide as a targeted bio-theragnostic system in antimicrobial photodynamic therapy against Porphyromonas gingivalis | Aptamer | TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA | 39 | N/A | ssDNA | Porphyromonas Gingivalis | Whole cell | DNA-aptamer-NGO, a targeted bio-theragnostic system against P. gingivalis for antimicrobial photodynamic therapy (aPDT). | MIC of DNA-aptamer-NGO was 62.5 nM, and MBC was 125 nM. aPDT using 1/2 × and 1/4 × MBC of DNA-aptamer-NGO plus irradiation of the diode laser light (1 min) has a significantly anti-biofilm effect; percentage of apoptosis cells treated with DNA-aptamer-NGO at 1/2 × and 1/4 × MIC plus diode laser were 13.9% and 12.7%; and 1/2 × MIC of DNA-aptamer-NGO, resulted in 40.3% inactivation of metabolic activity compared to 1/4 × MBC of DNA-aptamer-NGO, where only 22.2% inactivation. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | FAM Labeled | At high concentrations of DNA-aptamer-NGO, incubated for 24 hours with human red blood cells, the percentage did not exceed 5%. Also, at different concentrations, the mean percentage of HGF cell viability ranges from 95.2% to 87.6%. | N/A | N/A | N/A | N/A |
| ABdb_1639 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA76 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG-5’ | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1641 | https:doi.org10.1016j.snb.2022.132752 | 2022 | Novel nanozyme-catalyzed and magnetically assisted colorimetric biosensor for Staphylococcus aureus detection with a low matrix effect from complex environments | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Vancomycin-modified magnetic nanoparticles (Fe3O4 @Au-Van MNPs) combined with an aptamer were prepared for S. aureus detection. | The biosensor can distinguish more than 100 CFU/mL of pathogens by the naked eye and LOD of 2 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1648 | 35934373 | 2022 | A surface-enhanced Raman scattering aptasensor for Escherichia coli detection based on high-performance 3D substrate and hot spot effect | E. coli Apt | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed SERS aptasensor composed of Apt-AgNPs-CS gel and GNS@4-MBA-Apt NPs for detection of E. coli in food. | Display a detection limit of 3.46 CFU/mL with a wide dynamic linear range from 3.2 × 10(1) to 3.2 × 10(7) CFU/mL and a good recovery rate (>90%). | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1649 | https://doi.org/10.1021/acsanm.2c01548 | 2022 | Zirconium-Based Metal–Organic Framework and Ti3C2Tx Nanosheet-Based Faraday Cage-Type Electrochemical Aptasensor for Escherichia coli Detection | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | A Faraday-cage-type electrochemical aptasensor based on Zr-Fc MOF/AuNPs/4-MPBA framework was developed for the detection of E. coli O157:H7. | Display a detection limit of 3 CFU/mL and a linear range of 10-1.0 × 10(5) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate | N/A | 95.6% of the initial current of the aptasensor was reserved when stored for 14 days at 4°C. | N/A | N/A | N/A |
| ABdb_1650 | 35869107 | 2022 | An innovative dual recognition aptasensor for specific detection of Staphylococcus aureus based on Au/Fe3O4 binary hybrid | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an imprinted aptasensor (apt-AuNPs@ Fe3O4) for the quantification of S. aureus. | Exhibited a wide linear range of 10(1)-10(7) CFU/mL with a Limit of Detection (LOD ) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | The aptasensor retained approximately 95% of its original activity for four weeks. | N/A | N/A | N/A |
| ABdb_1651 | 35829778 | 2022 | An ultrasensitive sandwich-type electrochemical aptasensor using silver nanoparticle/titanium carbide nanocomposites for the determination of Staphylococcus aureus in milk | Apts | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 23656) | Whole cell | Developed a novel sandwich-type electrochemical aptasensor using AgNPs@Ti3C2 nanocomposites for the detection of S. aureus. | Showed a low detection limit (LOD) of 1 CFU/mL and a linear range of 52–5.2 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | 92.68% of the initial current of the aptasensor was reserved when stored for 15 days at 4°C. | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1653 | 35200347 | 2022 | Paper-Based Electrodes Conjugated with Tungsten Disulfide Nanostructure and Aptamer for Impedimetric Detection of Listeria monocytogenes | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor based on ePAD that employs a tungsten disulfide (WS2)/aptamer hybrid for the detection of L. monocytogenes. | The limit of detection (LoD) was 10 CFU/mL, with a linear range of 10(1)-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Aptasensor gives a stable impedance response over a period of 15 days. | N/A | N/A | N/A |
| ABdb_1654 | 35934342 | 2022 | Sandwich fluorometric method for dual-role recognition of Listeria monocytogenes based on antibiotic-affinity strategy and fluorescence quenching effect | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a sandwich fluorimetric method (MNPs-Van) for dual-role recognition of L. monocytogenes. | Achieved a low detection limit (LOD) of 2.8 × 10(2) CFU/mL in 1.5 h with a concentration range over 10(2)-2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1655 | https://doi.org/10.1016/j.snb.2022.131654 | 2022 | Dual recognition and highly sensitive detection of Listeria monocytogenes in food by fluorescence enhancement effect based on Fe3O4@ZIF-8-aptamer | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a fluorescence enhancement effect-based detection strategy based on Fe3O4@ZIF-8@aptamer for L. monocytogenes. | The linear range for detection of pure culture was 1.4 × 10(1) to 1.4 × 10(7) CFU/mL, with a detection limit of 0.88 CFU/mL in about 70 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1656 | 36418544 | 2022 | Colorimetric detection of Pseudomonas aeruginosa by aptamer-functionalized gold nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a colorimetric biosensor using aptamer-functionalized AuNPs for identifying P. aeruginosa. | P. aeruginosa was detected after 5 h for concentrations from 10(8) to 10(5) CFU/mL, with 10(5) and 10(4) CFU/mL being the detection limits for colour change by the naked eye and UV-Vis spectrometry, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1671 | 34329020 | 2022 | Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollution | A15-HP-Am | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA | 40 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115 and ATCC 7644) | Whole cell | BAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria. | Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml. | N/A | N/A | N/A | N/A |
| ABdb_1672 | 35850461 | 2022 | Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction | Aptamer | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Enterococcus Faecalis | Whole cell | Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity. | aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1679 | 35031253 | 2022 | Architecting of an aptasensor for the staphylococcus aureus analysis by modification of the screen-printed carbon electrode with aptamer/Ag-Cs-Gr QDs/NTiO2 | Aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | An electrochemical aptasensor employing Apt/Ag–Cs-Gr QDs/NTiO2/SPCE was developed for the detection of S. aureus. | Limit of Detection (LOD) of 3.3 CFU/mL and dynamic range of 10–5 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | Compared with the initial current response, the aptsensor response changed less than 10% after 100 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1701 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-1 | CCGGAATTCCTAATACGACTC-TGCGGACTGTATCGGTCGGTCGAAAATAGTGAAGTGC-TATTGAAACGCGGCCGCGG | 77 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1713 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | MPT64 aptamer | TTTTTTTTTTGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 44 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.82 ng/mL and a linear range of 0.75–250 ng/mL for MPT64 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1714 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | CFP10 aptamer | N/A | N/A | N/A | N/A | Mycobacterium Tuberculosis (M.Tb.) | CFP10 antigen | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.68 ng/mL and a linear range of 0.5–100 ng/mL for CFP10 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1715 | 35448289 | 2022 | Aptamer-Based Fluorescence Detection and Selective Disinfection of Salmonella Typhimurium by Using Hollow Carbon Nitride Nanosphere | S. typhimurium Apt | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop an off-on fluorescence aptasensor for the detection of S. typhimurium and use HCNS-Cap for disinfection. | The fluorescence assay showed a linear range of 30 to 3 × 10(4) CFU/mL and a detection limit of 13 CFU/mL. The bactericidal efficiency of HCNS-Cap (95.0%) within 12 h was better than that of HCNS (85.1%) and Cap (72.9%). | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1716 | 36205828 | 2022 | Aptamer-AuNP-conjugated carboxymethyl chitosan-functionalized graphene oxide for colorimetric identification of Salmonella typhimurium | S. typhimurium Aptamer | GCGCTCGGCCTCCTCTGCCATCTCATTCGCGAGCC | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a novel aptamer-AuNP-conjugated carboxymethyl chitosan–functionalized graphene oxide (CMC/GO@Apt-Au NP) probe for the determination of S. typhimurium. | Achieved a linear range from 10(2) to 10(7) CFU/mL with a limit of detection (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The relative response of aptasensor decreased to ~ 77% within 11 days of storage. | N/A | N/A | N/A |
| ABdb_1717 | 34693471 | 2022 | Electrochemical biosensor for detecting pathogenic bacteria based on a hybridization chain reaction and CRISPR-Cas12a | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An electrochemical biosensor platform based on HCR-based CRISPR-Cas12a for specific detection of S. typhimurium. | Selectively and sensitively quantify S. typhimurium in samples with detection limits of 20 CFU/mL and a linear range of 10-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1718 | 36058939 | 2022 | Multiple amplification-based fluorometric aptasensor for highly sensitive detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a fluorometric aptasensor for the detection of S. aureus using magnetic nanoparticles (MNPs). | The proposed fluorometric aptasensor displays LOD of (1.23 cfu/mL, a wide linear range (1 ~ 10(8) cfu/mL), and a fast detection speed (~ 1.5 h). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1719 | 34986439 | 2022 | Potentiometric aptasensing of Escherichia coli based on electrogenerated chemiluminescence as a highly sensitive readout | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 | Whole cell | Developed a potentiometric aptasensor by electrogenerated chemiluminescence (ECL) using SWCNTs-aptamer modified electrode to detect E. coli. | Shows a highly sensitive response to E. coli O157: H7 in the linear range of 5-1000 CFU/mL with a low detection limit of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1724 | 35270999 | 2022 | Detection of E. coli Bacteria in Milk by an Acoustic Wave Aptasensor with an Anti-Fouling Coating | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 74 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Developed an electromagnetic piezoelectric acoustic sensor device (EMPAS) based on SiO2-MEG-NH2-Aptamer for the detection of E.coli. in milk samples. | Selective measurement of E. coli in PBS and in cow’s milk samples down to limits of detection of 35 and 8 CFU/mL, respectively, with a linear range of 10–10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1739 | https://doi.org/10.1016/j.snb.2021.130933 | 2022 | Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophila | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | N/A | ssDNA | Legionella Pneumophila (Lp) strain Lp02 | Whole cell | SPRi-based titration assay using Lp aptamer for detecting L. pneumophila. | The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1740 | 36108985 | 2022 | Naked-eye detection of Staphylococcus aureus in powdered milk and infant formula using gold nanoparticles | Anti-S. aureus aptamer (Apt1) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (FPR3757 USA300) | Whole cell | Developed a colorimetric LSPR aptasensor using gold nanoparticles for the detection of S. aureus in milk and infant formula. | Could be visually detected within 30 min, with detection limits of 7.5 × 10(4) CFU/mL and 8.4 × 10(4) CFU/mL in milk and infant formula, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1741 | 34802926 | 2022 | Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separation | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus | Whole cell | Developed an aptansensor for Bacillus cereus detection based on up-conversion and magnetic nanomaterials (UCNPs-cDNA-Apt-MNPs complex). | Display a linear range of 49-49 × 10(6) cfu/mL under the optimal conditions with a detection limit of 22 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1742 | 36199343 | 2022 | Dual-mode sensor based on the synergy of magnetic separation and functionalized probes for the ultrasensitive detection of Clostridium perfringens | DNA walker Aptamer | TTTTTTTTTTTTTTTTTTTTTACAGAGCACGGGAATGTTACTGCCTGTTCAACGGCAGTAACATTAGC | 68 | N/A | ssDNA | Clostridium Perfringens | C. perfringens genomic DNA | Developed a dual-mode aptasensor using the synergy between fluorescent and electrochemical signals based on a DNA walker and hybridization chain reaction (HCR) for Clostridium perfringens detection. | Displayed an excellent analytical performance for C. perfringens at a concentration of 1 to 10(8) CFU/g and a minimum concentration of 1 CFU/g in real samples. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1743 | 36192057 | 2022 | Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplification | Aptamer 2 | CCTCCCTCCCTCCCTTTTTCCCACCCACCCACC | 33 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Developed an aptamer-based colorimetry sensor using a CRISPR/Cas12a system and recombinase polymerase amplification (RPA) for sensitive detection of MRSA. | MRSA was detected as low as 8 CFU/mL and can be quantified with a linear range of 10 CFU/mL to 10(5) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1744 | 35275270 | 2022 | DNAzyme-controlled plasmonic coupling for SERS-based determination of Salmonella typhimurium using hybridization chain reaction self-assembled G-quadruplex | Apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a SERS aptasensor based on hybridization chain reaction (HCR) self-assembled G-quadruplex DNAzyme (GQH DNAzyme)-controlled plasmonic coupling for S. typhimurium detection. | Display a linear range from 5 to 5.0 × 10(5) cfu/mL and the limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1745 | https://doi.org/10.1016/j.snb.2021.130839 | 2022 | A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobe | V.P-Apt | TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA | 38 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps. | Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The electrochemical signal retained 89.6% of its original value after 2 weeks. | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1747 | 37512948 | 2023 | Alpha-Gal Bound Aptamer and Vancomycin Synergistically Reduce Staphylococcus aureus Infection In Vivo | αSA31 | ATGATCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 49 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 33591) | Whole cell | αSA31 rescue α-1, 3-galactosyltransferase (−/−) knockout (GTKO) mice from induced MRSA sepsis. | 3.5-fold more (p < 0.05) pretreated MRSA were phagocytized when also treated with αSA31 and 7/12 mice treated with vancomycin plus αSA31 survived in-vivo. | N/A | N/A | N/A | Therapeutics | N/A | 5'-α-gal and 5'-Amidation (NH₂-(CH2)6) | No toxicity was observed, even at 10,000 µg/kg/day. | αSA31NH2 was significantly more stable (p < 0.01) in human serum, as no degradation was observed after 24 h at 37°C. | N/A | 5.222 h in Human serum. | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1770 | 38157041 | 2023 | A point-of-care aptasensor based on the upconversion nanoparticles/MoS2 FRET system for the detection of Pseudomonas aeruginosa infection | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on FRET between UCNPs-apt/MoS2 for rapid detection of P. aeruginosa. | Exhibit a wide linear detection range 8.7 × 10 ~ 8.7 × 10(7) cfu/mL, and a low limit of detection (LOD) of 15.5 cfu/mL within 1.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1771 | https://doi.org/10.1016/j.colsurfa.2023.131955 | 2023 | MoS2 nanosheets based label-free colorimetric aptasensor for Escherichia coli O157: H7 detection | Aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed colorimetric aptasensor based on aptamer-functionalized MoS2 nanosheets for the detection of E. coli O157: H7. | Detection of E. coli O157: H7 with a Limit of detection (LOD) of 116 CFU/mL and a linear concentration range of 500–5000 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1772 | 37286753 | 2023 | An ultrasensitive aptamer-based fluorescent on/off system for trace amount evaluation of Yersinia enterocolitica in food samples | Aptamer | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 79 | N/A | ssDNA | Yersinia Enterocolitica (PTCC 1786) | Whole cell | Fluorescence-based aptasensor using graphene oxide (GO) as a quenching platform was developed for the detection of Y. enterocolitica. | Exhibited a wide linear response in the concentration range 10 to 1.0 × 10(9) CFU/mL and the limit of detection (LOD) was 3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | FAM-aptamer-GO shows better stability in acidic environments, and pH 7 showed the greatest increase. It shows no obvious changes in fluorescence intensity within 60 days. | N/A | N/A | N/A |
| ABdb_1773 | 37921634 | 2023 | Aptamer and DNAzyme-Functionalized Cu-MOF Hybrid Nanozymes for the Monitoring and Management of Bacteria-Infected Wounds | Aptamer | GGGAAAGGGAAAGGGAAAGGG-TTTTTT-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGTGGACACGGTGGCTTAGTA | 102 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | MRSA surface components | G-quadruplex/hemin DNAzyme-aptamer probes and tannic acid-chelated Au nanoparticle (Au-TA)-decorated Cu-based MOF nanosheets (termed GATC) with triple-enzyme activities were developed for visual detection and efficient antibacterial therapy. | ~99.7% MRSA inactivation at 3 μg/mL, with simultaneous colorimetric monitoring of infection. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Thiolated | At 50 μg/mL GATC, the cells showed high viability (>90%), indicating negligible cytotoxicity and good cytocompatibility. The hemolysis rate of the GATC nanozyme was low (<5%). | N/A | N/A | N/A | N/A |
| ABdb_1774 | 37244192 | 2023 | High-throughput, highly sensitive and rapid SERS detection of Escherichia coli O157:H7 using aptamer-modified Au@macroporous silica magnetic photonic microsphere array | Aptamer | TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | An aptamer-Au@MMSPM SERS array biochip method was developed for the detection of E. coli O157:H7. | Gave a wide linear detection range (10–10(6) CFU/mL) and low limit of detection (2.20 CFU/mL) for E. coli O157:H7. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C12) (of Aptamer 1) and 3'-Amidation (NH₂-(CH2)6) (for Aptamer 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1775 | 37449120 | 2023 | Colorimetric aptasensor for detection of Bacillus cytotoxicus spores in milk and ready-to-use food | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus ssp. cytotoxicus (NVH 391-98A) | B. cytotoxicus spores | Develop a colorimetric assay employing AuNPs and magnetic particles (MPs) for the detection of Bacillus cytotoxicus spores in food. | Achieving the naked-eye limit of detection as low as 10(2) cfu/mL in water and milk, and 10(4) cfu/mL in mashed potatoes. | N/A | N/A | N/A | Biosensor | N/A | 5′-Thiolated and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1776 | 36906992 | 2023 | An ultrasensitive electrochemical aptasensor using Tyramide-assisted enzyme multiplication for the detection of Staphylococcus aureus | SA37 | GCTTCCAGCTTATTGAATAAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGGGCGCTGAAGCGCGGAAGC | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical aptasensor based on the tyramide signal amplification (TSA) technology was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 3 CFU/mL in buffer and 8 CFU/mL in both tap water and beef broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1777 | 36832038 | 2023 | Applicability of a Green Nanocomposite Consisted of Spongin Decorated Cu2WO4(OH)2 and AgNPs as a High-Performance Aptasensing Platform in Staphylococcus aureus Detection | Apt | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensing Platform based on a Green Nanocomposite consisting of Spongin Decorated Cu2WO4(OH)2 and AgNPs for Staphylococcus aureus detection. | Measured S. aureus under a linear concentration range of 10–10(8) CFU/mL and a limit of quantification and detection of 12 and 1 CFU/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1784 | https://doi.org/10.1016/j.snb.2023.133554 | 2023 | A novel Aptamer-induced CHA amplification strategy for ultrasensitive detection of Staphylococcus aureus and NIR-triggered photothermal bactericidal Activity based on aptamer-modified magnetic Fe3O4@AuNRs | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a Fe3O4 @AuNRs-aptasensor based on CHA for ultrasensitive detection of S. aureus. | Achieved a linear response ranging from 10(2) to 10(6) CFU/mL and a detection limit of 10(1) CFU/mL under optimal conditions. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1785 | https://doi.org/10.1016/j.cclet.2022.108102 | 2023 | Rapid detection of pathogenic bacteria based on a universal dual-recognition FRET sensing system constructed with aptamer-quantum dots and lectin-gold nanoparticles | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 21530) | Whole cell | Developed a dual-recognition-based sandwich FRET sensor using Aptamer-QDs and Con A-AuNPs for the detection of E. coli. | Achieved a linear detection range from 10(2) cfu/mL to 2 × 10(8) cfu/mL with the detection limit of 45 cfu/mL for E. coli, and LOD in the milk and orange juice was 300 cfu/mL and 200 cfu/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1786 | https://doi.org/10.1016/j.snb.2023.133745 | 2023 | Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed. | Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1787 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | K2 | AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG | 45 | N/A | ssDNA | Klebsiella Pneumoniae (KP) | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 5.377 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1788 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | AB | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 6.8 nM | Biosensor | N/A | 5'-Cyanine5 (Cy5) Labeled and 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1798 | 37187062 | 2023 | A universal bacterial sensor created by integrating a light modulating aptamer complex with photoelectrochemical signal readout | Peptidoglycan aptamer | GCAGTTGCGGGACAGGGAGTGCGCTGCTCCCC | 32 | N/A | ssDNA | Escherichia Coli (E. Coli) | Peptidoglycan | Developed a signal-on photoelectrochemical biosensor for detecting peptidoglycan. | Demonstrate a limit-of-detection of 82 pg/mL (13 pM) in buffer and 239 pg/mL (37 pM) in urine for peptidoglycan and 1913 CFU/mL for Escherichia coli in urine. | N/A | N/A | 0.415 ± 0.047 μM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1799 | 36961921 | 2023 | Dual Synthetic Receptor-Based Sandwich Electrochemical Sensor for Highly Selective and Ultrasensitive Detection of Pathogenic Bacteria at the Single-Cell Level | S. aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical sandwich sensor was developed for the detection of a single bacterial cell based on dual recognition by the bacteria-imprinted polymer film (BIF) and aptamer (Au@Fc-Apt). | The sensor could detect as low as 10 CFU/mL in a milk sample and 1 CFU/mL in PBS with a linear range from 10 to 10(5) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | After storage at 4°C for 17 days, the sensor still retained about 92% of the initial detection signal. | N/A | N/A | N/A |
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1809 | 37619902 | 2023 | Development of a label-free impedimetric aptasensor for the detection of Acinetobacter baumannii bacteria | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | An electrochemical aptasensor was developed using an aptamer immobilized on the surface of a CSPE modified with the nanocomposite Fe3O4@SiO2@Glyoxal (Gly) for A. baumannii detection. | Specifically detect A. baumannii in the concentration range from 1.0 × 10(3)–1.0 × 10(8) CFU/mL and with a detection limit of 150 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current response from 0 day to 28 days was 94.3%, 90%, and 86.5% of the primary Rct response of the aptasensor remained at 4°C after 14, 21 and 28 days, respectively. | N/A | N/A | N/A |
| ABdb_1811 | https://doi.org/10.3390/fishes8100477 | 2023 | A Novel Method for Sensitive Detection of Vibrio alginolyticus Based on Aptamer and Hybridization Chain Reaction in Aquaculture | Aptamer | GAGAGAGAATATAAGGGAAAAAAAATCAGTCGCTTCGCCGTCTCCTTCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAGACCCCAGAGGG | 104 | N/A | ssDNA | Vibrio Alginolyticus (ATCC 17749) | Whole cell | Developed a method using an HCR-based multivalent aptamer (multi-Apt) for the detection of Vibrio alginolyticus. | Obtained a linear range from 10 to 10(7) CFU/mL, and the limit of detection (LOD) is 3 CFU/mL. | N/A | N/A | N/A | Detection | N/A | SA-HRP or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1815 | https://doi.org/10.1016/j.cej.2023.143099 | 2023 | Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteria | Aptamer (AA) | AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 118 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA. | Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled and 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1816 | 36493674 | 2023 | Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification Strategy | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Developed a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection. | Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C. | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1818 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | E. coli aptamer | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1825 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | E. coli aptamer (P2) | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (BNCC 336902) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect E. coli with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1827 | 37311299 | 2023 | Joint concanavalin A-aptamer enabled dual recognition for anti-interference visual detection of Salmonella typhimurium in complex food matrices | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A dual recognition platform based on Concanavalin A (Con A)-aptamer joint strategy for sensitive determination of S. typhimurium. | Exhibited linear range of 7.0 × 10(1) ∼ 7.0 × 10(9) CFU/mL, along with a detection limit as low as 23 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1828 | 37466698 | 2023 | A signal-off aptasensor for the determination of Acinetobacter baumannii by using methylene blue as an electrochemical probe | Apt | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Developed an electrochemical aptasensor with Apt/MWCNT@Fe3O4@SiO2-Cl/CSPE nanocomposite to detect A. baumannii. | Display a linear range of 10.0–1.0 × 10(7) CFU/mL and a detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current density of the aptasensor for 10(5) CFU/mL of A. baumannii was approximately 92.3% of its initial signals after 21 days. | N/A | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1830 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Apt1 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (RN4220) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1831 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Sp14 | AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG | 69 | N/A | ssDNA | Bacillus Cereus (ATCC 14579) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1838 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1839 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1840 | 38770656 | 2024 | Sensitive and on-Site Detection of Staphylococcus aureus Based on CRISPR/Cas 13a-Assisted Chemiluminescence Resonance Energy Transfer | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a CRISPR/Cas 13a-assisted CRET-based strategy for the detection of S. aureus in real samples. | Successfully detected S. aureus in drinking water and milk with detection limits of 20 and 30 cfu/mL, respectively, within the recovery of 90.07–105.50%. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1841 | 39727901 | 2024 | Competitive Electrochemical Apta-Assay Based on cDNA-Ferrocene and MXenes for Staphylococcus aureus Surface Protein A Detection | APT | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Staphylococcus aureus Protein A (SpA) | Developed a competitive aptasensor based on a ferrocene (Fc)-labeled cDNA hybridized (cDNA-Fc S13) on a specific aptamer (APT) for PrA in the presence of MXene nanosheets for the indirect detection of S. aureus. | Displayed a linear range of 10–125 nM, an LOD of 3.33 nM, and a response time under 40 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1842 | 39533298 | 2024 | Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric method | B. melitensis-specific aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccine | Whole cell | Detection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction. | Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1843 | 39212695 | 2024 | Visual fluorescence detection of Listeria monocytogenes with CRISPR-Cas12a aptasensor | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptasensor utilizing carboxylated magnetic beads and Cas12a to detect L. monocytogenes. | Demonstrates excellent sensitivity towards L. monocytogenes, with a lowest detection limit (LOD) of 57.15 CFU/mL and a linear range of 4×10(2) to 4×10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1844 | 38150965 | 2024 | Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuni | ONS-23 | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33291) | Whole cell | Developed a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni. | Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1845 | 38006817 | 2024 | Electrocatalytic aptasensor for bacterial detection exploiting ferricyanide reduction by methylene blue on mixed PEG/aptamer monolayers | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Developed a disposable electrocatalytic “off–on” sensor for E. coli on Au SPE. | Exhibited a linear range of 10 to 1000 CFU/mL and LOD of 10 CFU/mL E. coli in 30 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated (thiol-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1846 | 38169279 | 2024 | "Five birds one stone" tri-modal monitoring driven lab-on-magnetic aptasensor for accurate pathogen detection and enhanced germicidal application | Anti-S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 65389) | Whole cell | A fluorescence-colorimetric-photothermal tri-modal sensing platform was developed for the detection of S. aureus by apt/KCl@CDs and magnetic multi-walled carbon nanotube composites (M-MWCNTs). | The detection limits of fluorescence, colorimetric and photothermal models were 4.81 cfu/mL, 3.40 cfu/mL and 6.74 cfu/mL, respectively with the same linear range of 10 - 1.0 ×10(7) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1847 | 38040292 | 2024 | One-pot rapid visual detection of E. coli O157:H7 by label-free AuNP-based plasmonic-aptasensor in water sample | (PGM) aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43895) | Whole cell | A label-free biosensor was developed using an aptamer and single-pot Au nanoparticle (AuNP) for the detection of E. coli O157:H7. | Could identify target bacteria with as few as 250 CFU/ml in 15 min or less. | N/A | N/A | N/A | Biosensor | N/A | 5'-Dodeca-G (G12) | N/A | After five days (stored at 4°C) from synthesizing PG-apt-AuNPs, its performance in detecting 10(5) CFU/ml of E. coli O157:H7 is similar to that of newly synthesized biosensor. | N/A | N/A | N/A |
| ABdb_1848 | 38452591 | 2024 | Aptamer-mediated double strand displacement amplification with microchip electrophoresis for ultrasensitive detection of Salmonella typhimurium | Aptamer (Apt) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-mediated double SDA-MCE method for ultrasensitive detection of S. typhimurium. | Achieved a linear range of 30–1.0 × 10(5) CFU/mL and the limit of detection for S. typhimurium down to 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1850 | https://doi.org/10.1016/j.electacta.2024.144240 | 2024 | Label-free electrochemical aptasensor for detection of Acinetobacter baumannii: Unveiling the kinetic behavior of reduced graphene oxide v/s graphene oxide | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC BAA-2800) | Whole cell | Developed an electrochemical aptasensor that employed a screen-printed carbon electrode modified with both graphene oxide (GO) and reduced graphene oxide (rGO) for the detection of AB. | Achieved an impressive limit of detection of 10 CFU/mL and a linear range of 10 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | The current response of aptasensor exhibited negligible changes in the CV signal even after the 4-week storage period. | N/A | N/A | N/A |
| ABdb_1851 | 38180496 | 2024 | Development of an electrochemical sensitive aptasensor based on a zeolite imidazolate framework-8 and gold nanoparticles for the determination of Staphylococcus aureus bacteria | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on a glassy carbon electrode (GCE) modified with zeolite imidazolate framework-8 (ZIF 8) and gold nanoparticles (AuNPs) for the detection of S. aureus. | Showed a linear response in the concentration range of 1.5 × 10(1) to 1.5 × 10(7) CFU mL−1 and a detection limit of 3.4 CFU/mL. | N/A | N/A | (9.04 ± 1.27) × 10(−1) nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) | N/A | Response of the proposed aptasensor reached 98.9%, 94.3%, and 92.8% of the initial response on the first, second, and third days, respectively, when kept at 4°C. | N/A | N/A | N/A |
| ABdb_1852 | 37751632 | 2024 | A novel paper-based electrochemiluminescence biosensor for non-destructive detection of pathogenic bacteria in real samples | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTGCTAACCCCCCTTAATCCCCCC | 104 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a paper-based electrochemiluminescence (ECL) aptasensor based on a Ru-MOF-5 NFs modified Indium tin oxide (ITO) electrode for the detection of S. aureus. | Exhibited a linear range from 5 to 10(8) CFU/mL, and a limit of detection (LOD) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | After 9 days at 4°C, the ECL signal of aptsensor retained 95.8% of its initial value, suggesting satisfactory storage stability. | N/A | N/A | N/A |
| ABdb_1853 | https://doi.org/10.1016/j.microc.2024.111428 | 2024 | Colorimetric and fluorescent dual-mode detection of Escherichia coli using Fe3O4 nanoparticle coated with fluorescein-labeled aptamer | E. coli aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed a dual-mode colorimetric and fluorescence assay employing Fe3O4 nanoparticles (NPs) coated with FAM-Apt for the identification of E. coli. | Acheived an impressive limit of detection (LOD) of 10 CFU/mL in the colorimetric mode and 6 CFU/mL in the fluorescence mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1854 | 39096325 | 2024 | Colorimetric aptasensor for Listeria monocytogenes detection using dual functional Fe3O4@MIL-100(Fe) with magnetic separation and oxidase-like activities in food samples | Aptamer | TACTATCGCGGGAGACAGCGCGGGAGGCACCGGGGA | 36 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a colorimetric aptasensor based on magnetic responsiveness and oxidase-like activity of Fe3O4@MIL-100(Fe) for the detection of L.monocytogenes. | The linear range was from 10(2) to 10(7) CFU/mL, with the limit of detection as low as 14 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1855 | 38805947 | 2024 | Aptamer-functionalized Fe3O4/MWCNTs@Mo-CDs nanozyme for rapid colorimetric detection toward Escherichia coli | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8099) | Whole cell | Peroxidase (POD)-like Fe3O4/MWCNTs@Mo-CDs (FMMC) nanozyme was developed for the colorimetric detection of E. coli. | Had a wide linear range of 10(1)–10(6) CFU/mL, low LOD of 0.978 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1869 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer1 | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1870 | 37639893 | 2024 | Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureus | Aptamer2 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs. | Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry). | N/A | N/A | N/A | Biosensor | N/A | 5'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1890 | 40308970 | 2025 | Aptamer-functionalized graphene quantum dots combined with artificial intelligence detect bacteria for urinary tract infections | Aptamer | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop an aptamer-functionalized graphene quantum dots integrated with an artificial intelligence detection system (AG-AI detection system) for the detection of E. coli. | Exhibits a wide linearity (10(3)-10(9) CFU/mL) and a low detection limit (3.38×10(2) CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1891 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt A04 | GGGAGCTCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | K88 fimbriae protein | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 34.51 ± 9.15 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt A04 indicated the lowest cytotoxicity (5.18%) at 100 nM | N/A | Best Candidate | N/A | N/A |
| ABdb_1892 | 40855524 | 2025 | Inhibition of Enterotoxigenic Escherichia coli adhesion via aptamers prevents infection in IPEC-J2 cells | K88-Apt 37 | GGAGACCGTACCATCTGTTCGTGGAAGCGCTTTGCTCGTCCATTAGCCTTGTGCTCGTGC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) ETEC K88 (CVCC 216) | Whole cell | An aptamer was identified to effectively inhibit the adhesion of ETEC K88 to intestinal epithelial cell IPEC-J2 and reduce ETEC K88-induced cytotoxicity in IPEC-J2 cells in vitro. | K88-Apt A04 may more effectively displace ETEC K88 and induce less cytotoxicity than K88-Apt 37, as it resulted in lower TNF-α expression. | N/A | N/A | 21.68 ± 4.65 nM | Therapeutics | N/A | 5'-FAM Labeled | K88-Apt 37 revealed the lowest cytotoxicity (8.77%) at 50 nM. | N/A | N/A | N/A | N/A |
| ABdb_1893 | 41245639 | 2025 | Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor | MPT64 aptamer sequence (17) | GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC | 40 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE). | Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT) | N/A | The aptasensor maintained good storage stability for up to 22 days. | N/A | N/A | N/A |
| ABdb_1894 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | LPS Aptamer | TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Lipopolysaccharide (LPS) | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect E. coli with a limit of detection of 2 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1903 | 41339596 | 2025 | Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen | Apt | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum. | The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value. | N/A | N/A | N/A |
| ABdb_1904 | 40517569 | 2025 | Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocomposite | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa. | Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1905 | 41123678 | 2025 | Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beverages | IsdA-specific aptamer | GCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU | 40 | N/A | ssRNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples. | The lowest detection limit for S. aureus was 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1906 | 40947925 | 2025 | Smartphone-Based Fluorescence/Colorimetric Dual-Mode Aptasensor for the Detection of Salmonella Using Multivalent Aptamer and CHA Amplification | Aptamer | GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a dual-mode portable fluorescent/colorimetric aptasensor, leveraging multivalent aptamer competitive assays and catalytic hairpin assembly (CHA) for the detection of Salmonella. | Enables the quantitative detection of Salmonella within a linear range of 10 to 10(7) CFU/mL, with detection limits of 28 CFU/mL for colorimetric detection and 10 CFU/mL for fluorescent detection. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1907 | 41149287 | 2025 | Real-Time and Selective Detection of Pseudomonas aeruginosa in Beef Samples Using a g-C3N4-Doped Multimetallic Perovskite-Based Electrochemical Aptasensor | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on aptamer functionalized FeCoCuNiO-g-C3N4 nanocomposite for the detection of P. aeruginosa in food samples. | Exhibited a low detection limit of 3.03 CFU/mL and over a range of 1 × 10(1)–1 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1908 | 40801776 | 2025 | Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii | KPC-2 KP aptamer | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGC | 60 | N/A | ssDNA | Klebsiella Pneumoniae carbapenemase 2-expressing K. Pneumoniae (KPC-2 KP) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB. | The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 7 CFU/mL for KPC-2 KP. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1909 | 40801776 | 2025 | Ultrasensitive Aptamer-Based Metal-Organic Framework-on-Metal-Organic Framework Platform for Clinical Detection of KPC-2 Klebsiella pneumoniae and Multidrug-Resistant Acinetobacter baumannii | MDR-AB aptamer | CAGGGGACGCACCAAGGTTTTGTTTTTTCTTTGCTTCTTTTTGCTTTTTTTTCCATGACCCGCGTGCTGCGTGA | 74 | N/A | ssDNA | Multidrug-resistant (MDR) Acinetobacter Baumannii | Whole cell | Developed a dual nanozyme-powered colorimetric aptasensor leveraging a cascade amplification mechanism, a metal-organic framework (MOF)-on-MOF nanostructure with peroxidase-like activity for detection of KPC-2 K. pneumoniae and MDR-AB. | The system achieves selective bacterial capture within 40 min, quantifying 10–10(8) CFU/mL with a detection limit of 6 CFU/mL for MDR-AB. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1910 | 40931301 | 2025 | A novel fluorescent aptasensor using magnetic silica nanospheres and Ag@MOF nanocomposites for extraction and detection of Salmonella Typhimurium in eggs | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGCATTATGACAG | 39 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (PTCC 1709) | Whole cell | Developed a fluorescent platform based on an aptamer-Ag@MOF and Fe3O4@KCC‐1 probes for the detection of S. Typhimurium in eggs. | Achieved a linear detection range of 7.5 to 7.5 × 10⁶ CFU/mL, a detection limit of 4.61 CFU/mL, and a total detection time of 90 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1911 | 40839054 | 2025 | SERS-based aptasensor for culture-free detection of Escherichia coli in urinary tract infection diagnosis | Aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Developed a SERS-based aptasensor for the detection of E. coli. | Demonstrated a detection limit of 5.9 × 10(3) CFU/mL, which is well below the UTI cutoff value. | N/A | N/A | N/A | Biosensor | N/A | 3'-BHQ2 | N/A | N/A | N/A | N/A | N/A |
| ABdb_1912 | 40437283 | 2025 | Target-triggered hybrid chain amplified fluorescence aptasensor based on label-free dye and MnO2 nanosheets system for Escherichia coli detection | AwI | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACCTGTACAAATCGTCTTGAT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed a label-free fluorescent detection system leveraging target-triggered hybridization chain reaction (HCR) amplification for E. coli detection. | Exhibited a detection limit of 17 CFU/mL and a broad dynamic range from 5.0 × 10(1) ~ 5.0 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1914 | 40335784 | 2025 | A novel strategy for ultrasensitive detection and effective inactivation of Staphylococcus aureus based on Fe3O4-QCS-PEI-Cu-aptamer and ladder-branch HCR | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an integrated strategy based on Fe3O4-quaternary ammonium chitosan-polyetherimide-Cu-aptamer (Fe3O4-QCS-PEI-Cu-aptamer) and ladder-branch hybridization chain reaction (HCR) for the detection and inactivation of S. aureus. | The sensor demonstrated a limit of detection (LOD) of 3 CFU/mL for S. aureus and, under near-infrared (NIR) irradiation, achieved an antimicrobial efficiency of 99.946%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 3'-COOH (Carboxylated) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1926 | 40136943 | 2025 | Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in Food | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | Developed a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs. | Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1927 | 39406088 | 2025 | Laser-induced graphene-based aptasensor for the selective detection of Escherichia coli in urine samples | P12-55 | CATACGATTTAGGTGACACTATAGCCGGAGGGGGGTGAGGTCTGCGGCAGGCTGTGTGGGTGGAATTTCTCCTACTGGGATAGGTGGA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an impedance biosensor using a Laser-Induced Graphene-based (LIG) electrode for the detection of E. coli in urine samples. | The aptasensor showed a linear response to E. coli over the range 10(0)-10(3) CFU/mL and LOD of 9 CFU/mL in PBS. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1928 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for V. parahaemolyticus was 3.70 × 10(6) CFU/mL and a linear range of 0.80-124 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1929 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for E. coli was 1.28 × 10(7) CFU/mL and a linear range of 6.50 - 153 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP2 (T2) , 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1930 | 40916637 | 2025 | Study of Bacteriostasis of Kaempferide on Foodborne Pathogenic Bacteria by Indirect Determination of Capillary Electrophoresis | AP3 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an aptamer-based capillary sieving electrophoresis (CE)-Laser-induced fluorescence (LIF) detection of three bacteria, Vibrio parahaemolyticus, Escherichia coli, and Staphylococcus aureus. | The measured limit of detection (LOD) for S. aureus was 1.67 × 10(7) CFU/mL and a linear range of 3.00-150 × 10(7) CFU/mL. | N/A | N/A | N/A | Detection | N/A | Extension chain for AP3 (T3), 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1931 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(S) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.2 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1932 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(E) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACACCTACCCATCGGA | 54 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (KCTC 2571) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.7 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1933 | https://doi.org/10.1016/j.snb.2024.136609 | 2025 | Ultrasensitive electrochemical biosensor for bacteria detection based on Fe3O4@COF-AuNPs and trigging isothermal circular amplification | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an ultrasensitive electrochemical biosensor based on magnetic nanocomposite material Fe3O4@COF-AuNPs and triggering isothermal circular amplification (TICA) for E. coli detection. | The detection limit (LOD) was 10 CFU/mL, with a linear range of 10(2)−10(9) CFU/mL, and the detection time was 1 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The sensor was stored at 4°C, and the signal value decreased by only 6.28 % over 30 days. | N/A | N/A | N/A |
| ABdb_1934 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 7.1 | ACACTAGATCAGTCACAG-GATTAAGGATCGTTGTTGGGTGGTTTCCGTAATTACTATC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1935 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 15.1 | ACACTAGATCAGTCACAG-GGTTGCTCAGGAGAAGGGAACGTGGGTGGTGGCGCGGACG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1936 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 3.1 | ACACTAGATCAGTCACAG-ACGGGGAGAGGGTCATCTCTGGTTTCGGGGTGCTAATTCT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1937 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 8.1 | ACACTAGATCAGTCACAG-CCCCGACCTGTACACGTACTACCCGATGACATTTGGTGTT-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1938 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 13.1 | ACACTAGATCAGTCACAG-TGGACGCGGCGGGCCGGATTAAGTTGAGGAGAGGGGGGTG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1939 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 16.1 | ACACTAGATCAGTCACAG-AGTATATATGGATTCCGCAACGTACGCAGGGGGTGTCGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1940 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 14.1 | ACACTAGATCAGTCACAG-CAGAGAGGGGCGGCGAGGGACAAAGGAGGGTAGGTGTGCC-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1941 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 12.1 | ACACTAGATCAGTCACAG-ATCACAGCGGAGGTTTAACGTGTGGCGGGTGTGGGGACATG-GACTTGACTCAGACATCT | 77 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1943 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 17.1 | ACACTAGATCAGTCACAG-AAGTGGAATCAAGCATGGGTATTTTAAGCATCGTATCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1944 | 41533198 | 2026 | Fluorescent aptasensor targeting the fibrinogen-binding domain of clumping factor A for rapid detection of Staphylococcus aureus | CA 5.1 | ACACTAGATCAGTCACAG-TGTTTCACGGGGGGGAGGGTAACGGAAGCTAATGGTCTCG-GACTTGACTCAGACATCT | 76 | 5'-ACACTAGATCAGTCACAG-N40-GACTTGACTCAGACATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Clumping factor A (ClfA) | Identify aptamers specific to ClfA and develop a fluorescence assay on the GO platform for its detection. | N/A | 11 | N/A | N/A | Detection | Ni-NTA affinity SELEX | 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1945 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt1 & Apt3 | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1946 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt2 & Apt4 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1947 | 41289776 | 2026 | Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications | Apt1 | CATCCGTCACACCTGCTCGGTGCAGACCCATAGGGGGGGCGTGCGGATGTGCGGAGTAGGGTGTTCGCTCCCGTATC | 77 | N/A | ssDNA | Bacillus Cereus strain INRA-SV-S51 | B. cereus spores | Developed an electrochemical aptasensor for the detection of B. cereus spores. | An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample. | N/A | N/A | N/A | Biosensor | N/A | 5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1948 | 41289776 | 2026 | Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications | Apt2 | CATCCGTCACACCTGCTCCCCAATGAAGCGAGATGGACGCCTAGCACCCCCCGCGTCCGGTGTTGGCTCCCGTATC | 76 | N/A | ssDNA | Bacillus Cereus strain INRA-SV-S51 | B. cereus spores | Developed an electrochemical aptasensor for the detection of B. cereus spores. | An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample. | N/A | N/A | N/A | Biosensor | N/A | 5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1949 | 41289776 | 2026 | Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applications | BAS6 | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus strain INRA-SV-S51 | B. cereus spores | Developed an electrochemical aptasensor for the detection of B. cereus spores. | An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample. | N/A | N/A | N/A | Biosensor | N/A | 5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1950 | 41135162 | 2026 | Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensor | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA | 86 | N/A | ssDNA | Shigella Dysenteriae | Whole cell | Developed an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae. | MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Long stability of up to 28 days at 4°C. | N/A | N/A | N/A |
| ABdb_1952 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-cholera whole toxin aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Vibrio Cholerae | Cholera toxin | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 40 ng in the cholera electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1956 | 17344350 | 2007 | Development and characterization of monoclonal antibodies and aptamers against major antigens of Mycobacterium avium subsp. paratuberculosis | Aptamer 94 | N/A | N/A | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Mycobacterium Avium subsp. paratuberculosis (ATCC 19698) | MAP0105c gene product | Identify aptamers that were screened against the MAP0105c gene product. | Bound specifically to the N-terminal half of MAP0105c, and nearly all mycobacteria tested. | 12 | N/A | N/A | Detection | Counter-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1957 | 19052851 | 2009 | Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detection | C2 and C3 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Surface protein | Identify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection. | Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices. | 5 | N/A | N/A | Biosensor | SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2009 | https://doi.org/10.1016/j.lwt.2013.12.012 | 2014 | Development and evaluation of aptamer magnetic capture assay in conjunction with real-time PCR for detection of Campylobacter jejuni | Aptamer 229 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (A9a) | Whole cell | Develop an aptamer-based magnetic capture-qPCR (AMC-qPCR) assay for the detection of Campylobacter jejuni. | Capture efficiency was 10–13% at the detection limit of 1.1 log10/300 μl C. jejuni cells and a range of 1.0–2.0 log10 CFU per sample (0.3-10 ml). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_2012 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-27 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2013 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-33 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-33 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2014 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-36 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-36 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2015 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-49 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2117 | 28342148 | 2017 | Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for Campylobacter | Aptamer | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Whole cell | Developed an aptamer-MB and aptamer-QD sandwich assay for the detection of C.jejuni. | Establishes a LOD between 5 and 10 C. jejuni cells/mL in sterile buffer (PBS) and chicken rinsate. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | U.S. Patent No. 9562900 |
| ABdb_2118 | 30382404 | 2018 | A bimodal (SERS and colorimetric) aptasensor for the detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | N/A | N/A | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | The dual-mode aptasensor based on SERS and colorimetry assay for the determination of P. aeruginosa. | LOD of the aptasensor was 20 cfu/mL for SERS mode and 50 cfu·mL−1 for color mode with a linear range from 10^2 cfu/mL to 10^6 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2120 | https://doi.org/10.1016/j.jelechem.2018.07.002 | 2018 | Target-induced aptamer displacement on gold nanoparticles and rolling circle amplification for ultrasensitive live Salmonella typhimurium electrochemical biosensing | S. typhimurium (STM)-binding aptamer. | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop an aptasensor for ultrasensitive detection of live S. typhimurium by combining target-induced aptamer displacement on gold nanoparticles (AuNPs) deposited electrode with rolling circle amplification (RCA). | Showed a LOD of 16 CFU/mL with a wide linear detection range of 20 to 2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | When the sensor was stored at 4°C for 10 days, the electrical signal response was 90% of that obtained at the time of preparation. | N/A | N/A | N/A |
| ABdb_2121 | 31700125 | 2019 | An aptasensor for the detection of Mycobacterium tuberculosis secreted immunogenic protein MPT64 in clinical samples towards tuberculosis detection | Aptamer | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 protein | Electrochemical impedance spectroscopy (EIS) aptasenosor based on an IDE for the detection of MPT64. | Display LOD of 4.1 fM and the specificity and sensitivity for the sputum sample analysis 100% and 76.47%, respectively, and for the serum sample analysis 100% and 88.24%, respectively. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH6)6-OP(O)2O-(CH2CH2O)6-5′-TTTTT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2122 | 33367418 | 2021 | Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSA | Aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300) | Whole cell | Aptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS. | Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2123 | 33395571 | 2021 | Aptasensor for the detection of Methicillin resistant Staphylococcus aureus on contaminated surfaces | AT0033 | N/A | N/A | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 25923) | Penicillin binding protein 2a (PBP2a) | Developed a colorimetric aptasensor for the detection of MRSA on contaminated surfaces. | The visual detection limit was less than 100 CFU/ml and, theoretically, 2 CFU/ml, while the linear range of quantitation was 10(2)–10(5) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2129 | 35765498 | 2022 | Single-stranded DNA aptamer-based rolling circle amplification as anti-chicken Salmonella bacteriostatic | Anti-Salmonella DNA aptamer | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) and Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer targeting Salmonella in the form of RCA-p that could inhibit bacterial growth, multiplication, and viability. | Significant reduction in bacterial viability. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2130 | 37773421 | 2023 | Sensitive detection of Escherichia coli in diverse foodstuffs by electrochemical aptasensor based on 2D porphyrin-based COF | Aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an electrochemical aptasensor using two-dimensional porphyrin-based covalent organic framework (Tph-TDC-COF) for the detection of E.coli. | Demonstrated an extremely low detection limit of 0.17 CFU/mL for E.coli detection within a linear range of 10 to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The aptasensor recovered to 104.3% after 15 days of storage at 4°C in 0.01 M phosphate buffer, indicating excellent stability. | N/A | N/A | N/A |
| ABdb_2131 | https://doi.org/10.1016/j.bioana.2024.05.004 | 2024 | Aptamer-carbon quantum dots and silver nanoparticles construct a FRET sensor for sensitive detection of E. coli | E. coli aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Whole cell | Developed a FRET-based fluorescent biosensor by combining CQDs with Ag NPs for the rapid detection of E. coli (BL21). | The sensor has a linear range of 2×10(3) ∼ to 2×10(8) CFU/mL and a low detection limit of 77 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |