Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 13
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0984 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-03 | CATATCCGCGTCGCTGCGCTCAGACCCACCACCACGCACC | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-03 showed better affinity to E. aerogenes, K. pneumoniae, C. freundii, and B. subtilis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.2 nM (for E. coli), 11.9 nM (for E. aerogenes), 9.22 nM (for K. pneumoniae), 15.9 nM (for C. freundii), 9.97 nM (for B. subtilis), and 16.4 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0993 | 28272554 | 2017 | Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX | STC-12 | GGACCGCAGGTGCACTGGGCGACGTCTCTGGGTGTGGTGT | 40 | 5'-CGTACGGAATTCGCTAGC-N40-GGATCCGAGCTCCACGTG-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571), Enterobacter aerogenes (E. aerogenes) (KCTC 2190), Klebsiella pneumoniae (K. pneumoniae) (KCTC 2208), Citrobacter freundii (C. freundii) (KCTC 2006), Bacillus Subtilis (B. Subtilis) (KCTC 1022), and Staphylococcus Epidermidis (S. Epidermidis) (KCTC 1917) | Whole cell | Identify aptamers with broad affinity for bacteria across different genera. | STC-12 showed better affinity to E. coli and S. epidermidis. | 18 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 38.5 nM (for E. coli), 33.7 nM (for E. aerogenes), 16.3 nM (for K. pneumoniae), 25.6 nM (for C. freundii), 18.9 nM (for B. subtilis), and 13.7 nM (for S. epidermidis) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1357 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–5 | GCAATGGTACGGTACTTCC-ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 3.9 ± 0.6 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1358 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–7 | GCAATGGTACGGTACTTCC-CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 8 ± 0.9 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1359 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20–10 | GCAATGGTACGGTACTTCC-TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 10.1 ± 1.7 nM | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1360 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-1 | GCAATGGTACGGTACTTCC-GATTAGCTACATTTGGTTGTTTACCGCTCTGCTTTCTATTATTT-CAAAAGTGCACGCTACTTTGCTAA | 87 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1361 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-2 | GCAATGGTACGGTACTTCC-TGTTAGTGTTTAAGGCCCAAAGTCGGTTCATCAGTACATTCCTCG-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1362 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-3 | GCAATGGTACGGTACTTCC-TTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAA-CAAAAGTGCACGCTACTTTGCTAA | 85 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1363 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-4 | GCAATGGTACGGTACTTCC-GATTGTGGTGGGGCCTCGAGATACCTGCGACCGGCATACTTGAAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1364 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-6 | GCAATGGTACGGTACTTCC-TTGCCCGTACACTGTCATCCTCGGCTTATAGCCATTATTGAAATT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1365 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-8 | GCAATGGTACGGTACTTCC-GGGCCTATACAGGCTTTTACTTCTGAGTTTGGTAGTTTCTTCGGA-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1366 | 31837967 | 2020 | Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method | 20-9 | GCAATGGTACGGTACTTCC-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Isolate aptamers against bacterial cells. | Aptamer selection was much faster compared to SELEX-based aptamer isolation. | 20 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | N/A | Detection | Centrifugation-based Partitioning Method | 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1970 | 23381690 | 2013 | Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay | Pool of enriched aptamers | N/A | N/A | 5'-TCAGTCGCTTCGCCGTCTCCTTC-N35-GCACAAGAGGGAGACCCCAGAGGG-3' | ssDNA | Vibrio Alginolyticus | Whole cell (Inactivated) | Identify aptamers against and qualitatively detect inactive Vibrio alginolyticus using PCR. | V. alginolyticus could be detected at 100 cells/ml. | 15 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.5 ± 9.2 nM | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |