Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1384 | 32993865 | 2020 | A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel | Aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P. | Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min. | N/A | Linearized adsorption isotherm | 16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt) | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | No significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained. | N/A | N/A | N/A |