AptBacterialDB

Determination of affinity method : Indirect ELASA (aptamer linked immunosorbent assay)

Total records found: 5

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1405 328107752020Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi ASal 1ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT875'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'ssDNASalmonella Paratyphi A (ATCC 9150)Whole cellIdentify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species.11Indirect ELASA (aptamer linked immunosorbent assay)N/ABiosensorWhole Cell-SELEXN/AN/AN/ABest CandidateN/AN/A
ABdb_1406 328107752020Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi ASal 2ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT875'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'ssDNASalmonella Paratyphi A (ATCC 9150)Whole cellIdentify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.The detection limit was 10(3) CFU/mL.11Indirect ELASA (aptamer linked immunosorbent assay)N/ABiosensorWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_1407 328107752020Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi ASal 3ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT875'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'ssDNASalmonella Paratyphi A (ATCC 9150)Whole cellIdentify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.N/A11Indirect ELASA (aptamer linked immunosorbent assay)N/ABiosensorWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_1408 328107752020Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi ASal 4ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT875'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'ssDNASalmonella Paratyphi A (ATCC 9150)Whole cellIdentify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.N/A11Indirect ELASA (aptamer linked immunosorbent assay)N/ABiosensorWhole Cell-SELEXN/AN/AN/AN/AN/AN/A
ABdb_1409 328107752020Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi ASal 5ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT875'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3'ssDNASalmonella Paratyphi A (ATCC 9150)Whole cellIdentify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A.N/A11Indirect ELASA (aptamer linked immunosorbent assay)N/ABiosensorWhole Cell-SELEXN/AN/AN/AN/AN/AN/A