AptBacterialDB

Determination of affinity method : Fluorescence Resonance Energy Transfer Assay (FRET)

Total records found: 7

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0080 204430502010A novel screening method for competitive FRET-aptamers applied to E. coli assay developmentEcO 4RATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT735'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) strain 8739 (Crooks strain)Outer membrane protein (OMP)Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.Detect as few as 30 live, unlabeled E. coli per ml using FRET assay.5Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)N/ABiosensorMagnetic Bead (MB)-based SELEX5'-Biotinylated and AlexaFluor 647 LabeledN/AN/ABest CandidateN/AN/A
ABdb_0081 204430502010A novel screening method for competitive FRET-aptamers applied to E. coli assay developmentEcO 3RATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT725'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'ssDNAEscherichia Coli (E. Coli) strain 8739 (Crooks strain)Outer membrane protein (OMP)Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.N/A5Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)N/ABiosensorMagnetic Bead (MB)-based SELEX5'-Biotinylated and AlexaFluor 647 LabeledN/AN/AN/AN/AN/A
ABdb_0082 204430502010A novel screening method for competitive FRET-aptamers applied to E. coli assay developmentEcO 8FATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT725'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3'ssDNAEscherichia Coli (E. Coli) strain 8739 (Crooks strain)Outer membrane protein (OMP)Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins.N/A5Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA)N/ABiosensorMagnetic Bead (MB)-based SELEX5'-Biotinylated and AlexaFluor 647 LabeledN/AN/AN/AN/AN/A
ABdb_1778 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT1-280ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T1-280 RNA was 113 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)2.2 ± 0.5 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1779 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT2-139040ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T2-139040 RNA was 17 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)1.0 ± 0.3 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1780 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersT3-117558ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC46N/AssRNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of T3-117558 RNA was 11 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)0.7 ± 0.4 nMDetectionIn-silico Method5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotideN/AN/AN/AN/AN/A
ABdb_1781 373272072023FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected AptamersA14ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT54N/AssDNAStaphylococcus aureus (S. aureus)Iron-regulated Surface Determinant Protein A (IsdA)Develop a FRET-based aptasensor for single-molecule detection of IsdA.LOD value of A14 DNA was 485 pM.N/AFluorescence Resonance Energy Transfer Assay (FRET)4 ± 2 nMDetectionN/A5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC)N/AN/AN/AN/AN/A